Morpholino
MO1-amer1
- ID
- ZDB-MRPHLNO-070822-1
- Name
- MO1-amer1
- Previous Names
- Target
- Sequence
-
5' - ACAGGTGACTGTGGCCTAATGGAGCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This is the correct sequence, the sequence published initially contained an extra base pair.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-amer1
No data available
Phenotype
Phenotype resulting from MO1-amer1
| Phenotype | Fish | Figures |
|---|---|---|
| eye decreased size, abnormal | WT + MO1-amer1 |
Fig. S5
from Major et al., 2007 |
| head malformed, abnormal | WT + MO1-amer1 |
Fig. S5
from Major et al., 2007 |
Phenotype of all Fish created by or utilizing MO1-amer1
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| eye decreased size, abnormal | WT + MO1-amer1 | standard conditions |
Fig. S5
from Major et al., 2007 |
| head malformed, abnormal | WT + MO1-amer1 | standard conditions |
Fig. S5
from Major et al., 2007 |
Citations