Morpholino

MO3-mef2d,mef2ca

ID

ZDB-MRPHLNO-070730-5

Name

MO3-mef2d,mef2ca

Previous Names

MO2-mef2d/c
MO3-mef2d+mef2c
MO3-mef2d+mef2ca

Targets

mef2ca (1)
mef2d (1)

Sequence

5' - GAATCTGGATCTTTTTCCTCCCCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Perfect match to mef2d sequence, very close to mef2c, predicted to knock down translation of both genes.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-mef2d,mef2ca

Expressed Gene	Anatomy	Figures
acta1b	(not) heart tube	Fig. 3 from Hinits et al., 2012
actc1b	skeletal muscle cell	Fig. 5 from Hinits et al., 2007
bmp4	(not) heart rudiment	Fig. S5 from Hinits et al., 2012
cdh5	endocardium head heart tube trunk	Fig. 5 , Fig. S4 from Hinits et al., 2012
en2a	(not) slow muscle cell	Fig. 3 from Hinits et al., 2007
gata4	anterior lateral plate mesoderm	Fig. S5 from Hinits et al., 2012
gata5	lateral plate mesoderm	Fig. S5 from Hinits et al., 2012
gata6	heart rudiment lateral plate mesoderm	Fig. 5 , Fig. S5 from Hinits et al., 2012
hand2	heart rudiment pharyngeal pouch	Fig. 5 from Hinits et al., 2012
hsp90aa1.1	skeletal muscle cell	Fig. 5 from Hinits et al., 2007
kdrl	vasculature	Fig. S4 from Hinits et al., 2012
mef2ca	(not) fast muscle cell (not) slow muscle cell	Fig. S2 from Hinits et al., 2007
mybpc1	(not) heart tube (not) slow muscle cell	Fig. 3 from Hinits et al., 2012 Fig. 5 from Hinits et al., 2007
myh7	(not) heart primordium	Fig. S5 from Hinits et al., 2012
myhz1.1	adaxial cell (not) fast muscle cell (not) fast muscle myoblast slow muscle cell	Fig. 2 , Fig. 5 , Fig. S4 from Hinits et al., 2007
myl7	(not) heart primordium	Fig. S5 from Hinits et al., 2012
mylpfa	(not) fast muscle cell	Fig. 5 from Hinits et al., 2007
myog	skeletal muscle cell	Fig. 2 from Hinits et al., 2007
nkx2.5	(not) heart rudiment	Fig. 5 from Hinits et al., 2012
nppa	(not) heart tube	Fig. 3 from Hinits et al., 2012
prdm1a	slow muscle cell	Fig. 3 from Hinits et al., 2007
smyd1b	(not) heart rudiment somite	Fig. S5 from Hinits et al., 2012
smyhc1	adaxial cell slow muscle cell	Fig. 2 , Fig. 3 , Fig. 5 , Fig. S3 from Hinits et al., 2007
tbx20	heart rudiment	Fig. 5 from Hinits et al., 2012
tnnc2.2	fast muscle cell (not) heart tube skeletal muscle cell	Fig. 3 from Hinits et al., 2012 Fig. 5 , Fig. S4 from Hinits et al., 2007
tpma	skeletal muscle cell	Fig. 5 from Hinits et al., 2007

Phenotype

Phenotype resulting from MO3-mef2d,mef2ca

No data available

Phenotype of all Fish created by or utilizing MO3-mef2d,mef2ca

Phenotype	Fish	Conditions	Figures
skeletal muscle myosin thick filament assembly disrupted, abnormal	WT + MO3-mef2d,mef2ca	standard conditions	Fig. 6 from Hinits et al., 2007
slow muscle cell immature, abnormal	WT + MO3-mef2d,mef2ca	standard conditions	Fig. 3 from Hinits et al., 2007
heart rudiment cardiac muscle cell disorganized, abnormal	WT + MO3-mef2d,mef2ca	standard conditions	Fig. 5 from Hinits et al., 2012
post-vent region curved ventral, abnormal	WT + MO3-mef2d,mef2ca	standard conditions	Fig. 2 from Hinits et al., 2007
heart formation arrested, abnormal	WT + MO3-mef2d,mef2ca	standard conditions	Fig. S5 from Hinits et al., 2012
fast muscle cell myofibril composition, abnormal	WT + MO3-mef2d,mef2ca	standard conditions	Fig. 2 , Fig. 6 from Hinits et al., 2007
heart rudiment aplastic, abnormal	WT + MO3-mef2d,mef2ca	standard conditions	Fig. S5 from Hinits et al., 2012
heart aplastic, abnormal	WT + MO3-mef2d,mef2ca	standard conditions	Fig. S5 from Hinits et al., 2012
myofibril assembly disrupted, abnormal	WT + MO3-mef2d,mef2ca	standard conditions	Fig. 2 , Fig. 3 from Hinits et al., 2007
slow muscle cell myofibril composition, abnormal	WT + MO3-mef2d,mef2ca	standard conditions	Fig. 3 , Fig. 6 from Hinits et al., 2007
cardiac muscle cell undifferentiated, abnormal	WT + MO3-mef2d,mef2ca	standard conditions	Fig. S5 from Hinits et al., 2012
cardiac muscle cell differentiation arrested, abnormal	WT + MO3-mef2d,mef2ca	standard conditions	Fig. S5 from Hinits et al., 2012
intersegmental vessel decreased length, abnormal	y1Tg + MO3-mef2d,mef2ca	standard conditions	Fig. S4 from Hinits et al., 2012
intersegmental vessel morphology, abnormal	y1Tg + MO3-mef2d,mef2ca	standard conditions	Fig. S4 from Hinits et al., 2012

Citations