header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070730-5
Morpholino Name: MO3-mef2d,mef2ca
Targets: mef2ca (1), mef2d (1)
Previous Names: MO2-mef2d/c, MO3-mef2d+mef2c, MO3-mef2d+mef2ca

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GAATCTGGATCTTTTTCCTCCCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Perfect match to mef2d sequence, very close to mef2c, predicted to knock down translation of both genes.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-mef2d,mef2ca No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-mef2d,mef2ca
Expressed Gene Anatomy Figures
acta1b Fig. 3 with image from Hinits et al., 2012
actc1b Fig. 5 with image from Hinits et al., 2007
bmp4 Fig. S5 with image from Hinits et al., 2012
cdh5 Fig. 5 with imageFig. S4 with image from Hinits et al., 2012
en2a Fig. 3 with image from Hinits et al., 2007
gata4 Fig. S5 with image from Hinits et al., 2012
gata5 Fig. S5 with image from Hinits et al., 2012
gata6 Fig. 5 with imageFig. S5 with image from Hinits et al., 2012
hand2 Fig. 5 with image from Hinits et al., 2012
hsp90aa1.1 Fig. 5 with image from Hinits et al., 2007
kdrl Fig. S4 with image from Hinits et al., 2012
mef2ca Fig. S2 with image from Hinits et al., 2007
mybpc1 Fig. 3 with image from Hinits et al., 2012
Fig. 5 with image from Hinits et al., 2007
myh7 Fig. S5 with image from Hinits et al., 2012
myhz1.1 Fig. 2 with imageFig. 5 with imageFig. S4 with image from Hinits et al., 2007
myl7 Fig. S5 with image from Hinits et al., 2012
mylpfa Fig. 5 with image from Hinits et al., 2007
myog Fig. 2 with image from Hinits et al., 2007
nkx2.5 Fig. 5 with image from Hinits et al., 2012
nppa Fig. 3 with image from Hinits et al., 2012
prdm1a Fig. 3 with image from Hinits et al., 2007
smyd1b Fig. S5 with image from Hinits et al., 2012
smyhc1 Fig. 2 with imageFig. 3 with imageFig. 5 with imageFig. S3 with image from Hinits et al., 2007
tbx20 Fig. 5 with image from Hinits et al., 2012
tnnc2 Fig. 3 with image from Hinits et al., 2012
Fig. 5 with imageFig. S4 with image from Hinits et al., 2007
tpma Fig. 5 with image from Hinits et al., 2007
PHENOTYPE
Phenotype resulting from MO3-mef2d,mef2ca
No data available

Phenotype of all Fish created by or utilizing MO3-mef2d,mef2ca
Phenotype Fish Conditions Figures
skeletal muscle myosin thick filament assembly disrupted, abnormal WT + MO3-mef2d,mef2ca standard conditions Fig. 6 with image from Hinits et al., 2007
slow muscle cell immature, abnormal WT + MO3-mef2d,mef2ca standard conditions Fig. 3 with image from Hinits et al., 2007
heart rudiment cardiac muscle cell disorganized, abnormal WT + MO3-mef2d,mef2ca standard conditions Fig. 5 with image from Hinits et al., 2012
post-vent region curved ventral, abnormal WT + MO3-mef2d,mef2ca standard conditions Fig. 2 with image from Hinits et al., 2007
heart formation arrested, abnormal WT + MO3-mef2d,mef2ca standard conditions Fig. S5 with image from Hinits et al., 2012
fast muscle cell myofibril composition, abnormal WT + MO3-mef2d,mef2ca standard conditions Fig. 2 with imageFig. 6 with image from Hinits et al., 2007
heart rudiment aplastic, abnormal WT + MO3-mef2d,mef2ca standard conditions Fig. S5 with image from Hinits et al., 2012
heart aplastic, abnormal WT + MO3-mef2d,mef2ca standard conditions Fig. S5 with image from Hinits et al., 2012
slow muscle cell myofibril composition, abnormal WT + MO3-mef2d,mef2ca standard conditions Fig. 3 with imageFig. 6 with image from Hinits et al., 2007
myofibril assembly disrupted, abnormal WT + MO3-mef2d,mef2ca standard conditions Fig. 2 with imageFig. 3 with image from Hinits et al., 2007
cardiac muscle cell undifferentiated, abnormal WT + MO3-mef2d,mef2ca standard conditions Fig. S5 with image from Hinits et al., 2012
cardiac muscle cell differentiation arrested, abnormal WT + MO3-mef2d,mef2ca standard conditions Fig. S5 with image from Hinits et al., 2012
intersegmental vessel decreased length, abnormal y1Tg + MO3-mef2d,mef2ca standard conditions Fig. S4 with image from Hinits et al., 2012
intersegmental vessel morphology, abnormal y1Tg + MO3-mef2d,mef2ca standard conditions Fig. S4 with image from Hinits et al., 2012
OTHER MO3-mef2d,mef2ca MORPHOLINO PAGESNo links to external sites
CITATIONS (2)