Morpholino

MO2-daam1a

ID
ZDB-MRPHLNO-070712-4
Name
MO2-daam1a
Previous Names
  • MO2-daam1
Target
Sequence
5' - AGCTATGACCCCCTCTCAAAATGGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-daam1a
No data available
Phenotype
Phenotype resulting from MO2-daam1a
Phenotype Fish Figures
dendrite morphogenesis disrupted, abnormal WT + MO2-daam1a Fig. 4 with image,  Fig. 6 with image from Colombo et al., 2013
dorsal habenular nucleus neuron morphology, abnormal WT + MO2-daam1a Fig. 4 with image from Colombo et al., 2013
dorsal habenular nucleus neuron projection decreased amount, abnormal rw0110bTg + MO2-daam1a Fig. 2 with image,  Fig. 3 with image from Colombo et al., 2013
dorsal habenular nucleus neuron projection terminus incomplete structure, abnormal WT + MO2-daam1a Fig. 4 with image from Colombo et al., 2013
habenula cytoskeleton organization decreased process quality, abnormal WT + MO2-daam1a Fig. 5 with image from Colombo et al., 2013
habenula dendrite decreased volume, abnormal rw0110bTg + MO2-daam1a Fig. 2 with image,  Fig. 3 with image,  Fig. 6 with image from Colombo et al., 2013
habenula dendrite truncated, abnormal WT + MO2-daam1a Fig. 4 with image from Colombo et al., 2013
habenula determination of left/right asymmetry in diencephalon process quality, abnormal rw0110bTg + MO2-daam1a Fig. 2 with image from Colombo et al., 2013
habenula filamentous actin disorganized, abnormal WT + MO2-daam1a Fig. 5 with image from Colombo et al., 2013
habenula development disrupted, abnormal WT + MO2-daam1a Fig. 6 with image from Colombo et al., 2013
habenula development process quality, abnormal WT + MO2-daam1a Fig. 2 with image,  Fig. 4 with image from Colombo et al., 2013
interpeduncular nucleus tegmentum innervation process quality, abnormal rw0110bTg + MO2-daam1a Fig. 2 with image,  Fig. 3 with image,  Fig. 4 with image from Colombo et al., 2013
regulation of dendrite morphogenesis process quality, abnormal WT + MO2-daam1a Fig. 4 with image from Colombo et al., 2013
Phenotype of all Fish created by or utilizing MO2-daam1a
Phenotype Fish Conditions Figures
habenula filamentous actin disorganized, abnormal WT + MO2-daam1a standard conditions Fig. 5 with image from Colombo et al., 2013
habenula dendrite truncated, abnormal WT + MO2-daam1a standard conditions Fig. 4 with image from Colombo et al., 2013
dendrite morphogenesis disrupted, abnormal WT + MO2-daam1a standard conditions Fig. 4 with image,  Fig. 6 with image from Colombo et al., 2013
dorsal habenular nucleus neuron morphology, abnormal WT + MO2-daam1a standard conditions Fig. 4 with image from Colombo et al., 2013
interpeduncular nucleus tegmentum innervation process quality, abnormal WT + MO2-daam1a standard conditions Fig. 4 with image from Colombo et al., 2013
regulation of dendrite morphogenesis process quality, abnormal WT + MO2-daam1a standard conditions Fig. 4 with image from Colombo et al., 2013
habenula development process quality, abnormal WT + MO2-daam1a standard conditions Fig. 4 with image from Colombo et al., 2013
habenula development disrupted, abnormal WT + MO2-daam1a standard conditions Fig. 6 with image from Colombo et al., 2013
habenula cytoskeleton organization decreased process quality, abnormal WT + MO2-daam1a standard conditions Fig. 5 with image from Colombo et al., 2013
dorsal habenular nucleus neuron projection terminus incomplete structure, abnormal WT + MO2-daam1a standard conditions Fig. 4 with image from Colombo et al., 2013
habenula dendrite decreased volume, abnormal WT + MO2-daam1a standard conditions Fig. 6 with image from Colombo et al., 2013
dorsal habenular nucleus neuron projection decreased amount, abnormal rw0110bTg + MO2-daam1a standard conditions Fig. 2 with image,  Fig. 3 with image from Colombo et al., 2013
interpeduncular nucleus tegmentum innervation process quality, abnormal rw0110bTg + MO2-daam1a standard conditions Fig. 2 with image,  Fig. 3 with image from Colombo et al., 2013
habenula development process quality, abnormal rw0110bTg + MO2-daam1a standard conditions Fig. 2 with image from Colombo et al., 2013
habenula dendrite decreased volume, abnormal rw0110bTg + MO2-daam1a standard conditions Fig. 2 with image,  Fig. 3 with image from Colombo et al., 2013
habenula determination of left/right asymmetry in diencephalon process quality, abnormal rw0110bTg + MO2-daam1a standard conditions Fig. 2 with image from Colombo et al., 2013
post-vent region bent, abnormal WT + MO1-daam1b + MO2-daam1a standard conditions Fig. S9 with image from Kida et al., 2007
eye fused with eye, abnormal WT + MO1-daam1b + MO2-daam1a standard conditions Fig. S9 with image from Kida et al., 2007
post-vent region decreased length, abnormal WT + MO1-daam1b + MO2-daam1a standard conditions Fig. S9 with image from Kida et al., 2007
post-vent region bent, abnormal WT + MO1-daam2 + MO2-daam1a standard conditions Fig. S9 with image from Kida et al., 2007
post-vent region decreased length, abnormal WT + MO1-daam2 + MO2-daam1a standard conditions Fig. S9 with image from Kida et al., 2007
eye fused with eye, abnormal WT + MO1-daam2 + MO2-daam1a standard conditions Fig. S9 with image from Kida et al., 2007
habenula development disrupted, abnormal WT + MO2-daam1a + MO2-ulk2 standard conditions Fig. 6 with image from Colombo et al., 2013
dendrite morphogenesis disrupted, abnormal WT + MO2-daam1a + MO2-ulk2 standard conditions Fig. 6 with image from Colombo et al., 2013
habenula dendrite decreased volume, abnormal WT + MO2-daam1a + MO2-ulk2 standard conditions Fig. 6 with image from Colombo et al., 2013
post-vent region bent, abnormal WT + MO1-daam1b + MO1-daam2 + MO2-daam1a standard conditions Fig. S9 with image from Kida et al., 2007
post-vent region decreased length, abnormal WT + MO1-daam1b + MO1-daam2 + MO2-daam1a standard conditions Fig. S9 with image from Kida et al., 2007
eye aplastic, abnormal WT + MO1-daam1b + MO1-daam2 + MO2-daam1a standard conditions Fig. S9 with image from Kida et al., 2007
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.