Morpholino

MO5-notch1a

ID

ZDB-MRPHLNO-070622-1

Name

MO5-notch1a

Previous Names

None

Target

notch1a (1)

Sequence

5' - GTAGTGTTAAACTGTTACCTTGTGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

blocks splicing at exon1-intron1 boundary

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO5-notch1a

Expressed Gene	Anatomy	Figures
dlc	dorsal aorta	Fig. S4 from Kim et al., 2014
efnb2a	dorsal aorta	Fig. S4 from Kim et al., 2014
foxc1b	sclerotome	Fig. S4 from Kim et al., 2014
gata2a	dorsal aorta vascular endothelium	Fig. 7 from Butko et al., 2015
gata2b	ventral wall of dorsal aorta	Fig. 7 from Butko et al., 2015
kdrl	endothelial cell	Fig. S4 from Kim et al., 2014
myod1	somite	Fig. S4 from Kim et al., 2014
runx1	hematopoietic multipotent progenitor cell ventral wall of dorsal aorta	Fig. 7 from Butko et al., 2015 Fig. S4 from Kim et al., 2014
twist1b	sclerotome	Fig. S4 from Kim et al., 2014

Phenotype

Phenotype resulting from MO5-notch1a

Phenotype	Fish	Figures
dorsal aorta development process quality, abnormal	AB + MO5-notch1a	Fig. S4 from Kim et al., 2014
hematopoietic progenitor cell differentiation process quality, abnormal	AB + MO5-notch1a	Fig. S4 from Kim et al., 2014
hindbrain has extra parts of type Mauthner neuron, abnormal	ue1Tg; ue2Tg + MO5-notch1a	Fig. 1 from Almeida et al., 2018
spinal cord anterior region has extra parts of type Mauthner neuron axon, abnormal	ue1Tg; ue2Tg + MO5-notch1a	Fig. 1 from Almeida et al., 2018
vasculature development process quality, abnormal	AB + MO5-notch1a	Fig. S4 from Kim et al., 2014

Phenotype of all Fish created by or utilizing MO5-notch1a

Phenotype	Fish	Conditions	Figures
hematopoietic progenitor cell differentiation process quality, abnormal	AB + MO5-notch1a	standard conditions	Fig. S4 from Kim et al., 2014
dorsal aorta development process quality, abnormal	AB + MO5-notch1a	standard conditions	Fig. S4 from Kim et al., 2014
vasculature development process quality, abnormal	AB + MO5-notch1a	standard conditions	Fig. S4 from Kim et al., 2014
hindbrain has extra parts of type Mauthner neuron, abnormal	ue1Tg; ue2Tg + MO5-notch1a	standard conditions	Fig. 1 from Almeida et al., 2018
spinal cord anterior region has extra parts of type Mauthner neuron axon, abnormal	ue1Tg; ue2Tg + MO5-notch1a	standard conditions	Fig. 1 from Almeida et al., 2018
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, exacerbated	WT + MO2-tnfrsf1b + MO5-notch1a	standard conditions	Fig. 4 from Espín-Palazón et al., 2014
hindbrain has extra parts of type Mauthner neuron, abnormal	kifbp^st23/st23; ue1Tg; ue2Tg + MO5-notch1a	standard conditions	Fig. 1 from Almeida et al., 2018
oligodendrocyte myelin sheath separated from neuron cell body, ameliorated	kifbp^st23/st23; ue1Tg; ue2Tg + MO5-notch1a	standard conditions	Fig. 1 from Almeida et al., 2018
spinal cord anterior region has extra parts of type Mauthner neuron axon, abnormal	kifbp^st23/st23; ue1Tg; ue2Tg + MO5-notch1a	standard conditions	Fig. 1 from Almeida et al., 2018
oligodendrocyte myelin sheath distal to neuron cell body, ameliorated	kifbp^st23/st23; ue1Tg; ue2Tg + MO5-notch1a	standard conditions	Fig. 1 from Almeida et al., 2018

Citations