Morpholino
MO6-notch3
- ID
- ZDB-MRPHLNO-070614-5
- Name
- MO6-notch3
- Previous Names
- None
- Target
- Sequence
-
5' - AAGGATCAGTCATCTTACCTTCGCT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO6-notch3
No data available
Phenotype
Phenotype resulting from MO6-notch3
1 - 5 of 7 Show all
Phenotype of all Fish created by or utilizing MO6-notch3
1 - 5 of 21 Show all
Citations
- Lu, Y.F., Liu, D.W., Li, I.C., Lin, J., Wang, C.M., Chu, K.C., Kuo, H.H., Lin, C.Y., Yih, L.H., Jiang, Y.J., Hwang, S.L. (2021) Delta/Jagged-mediated Notch signaling induces the differentiation of agr2-positive epidermal mucous cells in zebrafish embryos. PLoS Genetics. 17:e1009969
- Campbell, L.J., Hobgood, J.S., Jia, M., Boyd, P., Hipp, R.I., Hyde, D.R. (2020) Notch3 and DeltaB maintain Müller glia quiescence and act as negative regulators of regeneration in the light-damaged zebrafish retina. Glia. 69(3):546-566
- Kim, A.D., Melick, C.H., Clements, W.K., Stachura, D.L., Distel, M., Panáková, D., MacRae, C., Mork, L.A., Crump, J.G., Traver, D. (2014) Discrete Notch signaling requirements in the specification of hematopoietic stem cells. The EMBO journal. 33(20):2363-73
- Alunni, A., Krecsmarik, M., Bosco, A., Galant, S., Pan, L., Moens, C.B., and Bally-Cuif, L. (2013) Notch3 signaling gates cell cycle entry and limits neural stem cell amplification in the adult pallium. Development (Cambridge, England). 140(16):3335-47
- Ma, M., and Jiang, Y.J. (2007) Jagged2a-notch signaling mediates cell fate choice in the zebrafish pronephric duct. PLoS Genetics. 3(1):e18
1 - 5 of 5
Show