Morpholino

MO6-notch3

ID
ZDB-MRPHLNO-070614-5
Name
MO6-notch3
Previous Names
None
Target
Sequence
5' - AAGGATCAGTCATCTTACCTTCGCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO6-notch3
No data available
Phenotype
Phenotype resulting from MO6-notch3
Phenotype of all Fish created by or utilizing MO6-notch3
Phenotype Fish Conditions Figures
dorsal telencephalon radial glial cell proliferative, abnormal AB + MO6-notch3 standard conditions Fig. 5 with image from Alunni et al., 2013
hematopoietic stem cell differentiation process quality, abnormal AB + MO6-notch3 standard conditions Fig. 1 from Kim et al., 2014
radial glial cell division in pallium increased occurrence, abnormal AB + MO6-notch3 standard conditions Fig. 5 with image from Alunni et al., 2013
hematopoietic progenitor cell differentiation process quality, abnormal AB + MO6-notch3 standard conditions Fig. 1Fig. 6 from Kim et al., 2014
hemopoiesis process quality, abnormal AB + MO6-notch3 standard conditions Fig. 1 from Kim et al., 2014
sclerotome development process quality, abnormal AB + MO6-notch3 standard conditions Fig. 2Fig. 6 from Kim et al., 2014
sclerotome development process quality, abnormal WT + MO6-notch3 standard conditions Fig. S2 from Kim et al., 2014
thymus development process quality, abnormal zdf8Tg + MO6-notch3 standard conditions Fig. 1 from Kim et al., 2014
sclerotome development process quality, abnormal dlctit446/+ + MO6-notch3 (AB) standard conditions Fig. 6 from Kim et al., 2014
hematopoietic progenitor cell differentiation process quality, abnormal dlctit446/+ + MO6-notch3 (AB) standard conditions Fig. 6 from Kim et al., 2014
sclerotome development process quality, abnormal AB + MO2-dld + MO6-notch3 standard conditions Fig. 6 from Kim et al., 2014
hematopoietic progenitor cell differentiation process quality, abnormal AB + MO2-dld + MO6-notch3 standard conditions Fig. 6 from Kim et al., 2014
dorsal aorta development process quality, abnormal AB + MO6-notch1b + MO6-notch3 standard conditions Fig. S5 from Kim et al., 2014
hematopoietic progenitor cell differentiation process quality, abnormal AB + MO6-notch1b + MO6-notch3 standard conditions Fig. S5 from Kim et al., 2014
hematopoietic progenitor cell differentiation process quality, abnormal bw9Tg; kca3Tg + MO6-notch3 standard conditions Fig. 5 from Kim et al., 2014
hematopoietic progenitor cell differentiation process quality, abnormal hzm7Et; kca3Tg + MO6-notch3 standard conditions Fig. 5 from Kim et al., 2014
hematopoietic multipotent progenitor cell decreased amount, abnormal kca3Tg; kca4Tg + MO6-notch3 standard conditions Fig. 3 from Kim et al., 2014
hematopoietic progenitor cell differentiation process quality, abnormal kca3Tg; kca4Tg + MO6-notch3 standard conditions Fig. 3 from Kim et al., 2014
hemopoiesis process quality, abnormal la4Tg; zf169Tg + MO6-notch3 standard conditions Fig. 1 from Kim et al., 2014
hematopoietic stem cell differentiation process quality, abnormal la4Tg; zf169Tg + MO6-notch3 standard conditions Fig. 1 from Kim et al., 2014
hematopoietic progenitor cell differentiation process quality, abnormal la4Tg; zf169Tg + MO6-notch3 standard conditions Fig. 1 from Kim et al., 2014
Citations