header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070606-1
Morpholino Name: MO1-ppm1k
Target: ppm1k (1)
Previous Name: PP2CmATG (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ACATGCTCAGTGGCAGAAAACCACA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ppm1k No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ppm1k
Expressed Gene Anatomy Figures
bmp4 Fig. S9 from Lu et al., 2007
foxa3 Fig. 7 from Lu et al., 2007
myh6 Fig. 7 from Lu et al., 2007
myh7 Fig. 7 from Lu et al., 2007
notch1b Fig. S9 from Lu et al., 2007
PHENOTYPE
Phenotype resulting from MO1-ppm1k
Phenotype of all Fish created by or utilizing MO1-ppm1k
OTHER MO1-ppm1k MORPHOLINO PAGESNo links to external sites
CITATIONS (1)