Morpholino

MO1-ppm1kb

ID
ZDB-MRPHLNO-070606-1
Name
MO1-ppm1kb
Previous Names
  • MO1-ppm1k
  • PP2CmATG (1)
Target
Sequence
5' - ACATGCTCAGTGGCAGAAAACCACA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ppm1kb
Expressed Gene Anatomy Figures
bmp4 Fig. S9 from Lu et al., 2007
foxa3 Fig. 7 from Lu et al., 2007
myh6 Fig. 7 from Lu et al., 2007
myh7 Fig. 7 from Lu et al., 2007
notch1b Fig. S9 from Lu et al., 2007
Phenotype
Phenotype resulting from MO1-ppm1kb
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal AB + MO1-ppm1kb Fig. S7 from Lu et al., 2007
blood circulation disrupted, abnormal AB + MO1-ppm1kb text only from Lu et al., 2007
brain malformed, abnormal AB + MO1-ppm1kb Fig. 7 from Lu et al., 2007
brain development disrupted, abnormal AB + MO1-ppm1kb Fig. 7 from Lu et al., 2007
digestive system malformed, abnormal AB + MO1-ppm1kb Fig. 7 from Lu et al., 2007
digestive tract development disrupted, abnormal AB + MO1-ppm1kb Fig. 7 from Lu et al., 2007
endocardial ring malformed, abnormal AB + MO1-ppm1kb Fig. S9 from Lu et al., 2007
gut malformed, abnormal AB + MO1-ppm1kb Fig. 7 from Lu et al., 2007
heart malformed, abnormal AB + MO1-ppm1kb Fig. 7,  Fig. S9 from Lu et al., 2007
heart contraction decreased rate, abnormal twu34Tg + MO1-ppm1kb Fig. 7 from Lu et al., 2007
heart development disrupted, abnormal AB + MO1-ppm1kb Fig. S9 from Lu et al., 2007
heart looping disrupted, abnormal AB + MO1-ppm1kb Fig. 7 from Lu et al., 2007
Phenotype of all Fish created by or utilizing MO1-ppm1kb
Phenotype Fish Conditions Figures
blood circulation disrupted, abnormal AB + MO1-ppm1kb standard conditions text only from Lu et al., 2007
apoptotic process increased occurrence, abnormal AB + MO1-ppm1kb standard conditions Fig. S7 from Lu et al., 2007
heart looping disrupted, abnormal AB + MO1-ppm1kb standard conditions Fig. 7 from Lu et al., 2007
brain malformed, abnormal AB + MO1-ppm1kb standard conditions Fig. 7 from Lu et al., 2007
heart development disrupted, abnormal AB + MO1-ppm1kb standard conditions Fig. S9 from Lu et al., 2007
digestive system malformed, abnormal AB + MO1-ppm1kb standard conditions Fig. 7 from Lu et al., 2007
endocardial ring malformed, abnormal AB + MO1-ppm1kb standard conditions Fig. S9 from Lu et al., 2007
heart malformed, abnormal AB + MO1-ppm1kb standard conditions Fig. 7,  Fig. S9 from Lu et al., 2007
gut malformed, abnormal AB + MO1-ppm1kb standard conditions Fig. 7 from Lu et al., 2007
digestive tract development disrupted, abnormal AB + MO1-ppm1kb standard conditions Fig. 7 from Lu et al., 2007
brain development disrupted, abnormal AB + MO1-ppm1kb standard conditions Fig. 7 from Lu et al., 2007
heart contraction decreased rate, abnormal twu34Tg + MO1-ppm1kb standard conditions Fig. 7 from Lu et al., 2007
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.