Morpholino

MO1-tcf7

ID

ZDB-MRPHLNO-070605-7

Name

MO1-tcf7

Previous Names

None

Target

Sequence

5' - AGCTGCGGCATGATCCAAACTTTCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

translation-blocker

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-tcf7

Expressed Gene	Anatomy	Figures
dbx2	spinal cord	Fig. 3 from Bonner et al., 2008
gdf6a	roof plate spinal cord region	Fig. 3 from Bonner et al., 2008
klf17	posterior lateral line neuromast	Fig. 2 from Aman et al., 2011
msx3	roof plate spinal cord region spinal cord	Fig. 3 from Bonner et al., 2008
nkx6.2	spinal cord	Fig. 3 from Bonner et al., 2008
pax3a	spinal cord	Fig. 3 from Bonner et al., 2008
sox3	neural plate	Fig. S2 from Bonner et al., 2008
tcf7	whole organism	Fig. S2 from Bonner et al., 2008
tcf7l1a	spinal cord	Fig. 4 from Bonner et al., 2008
tcf7l1b	spinal cord	Fig. 4 from Bonner et al., 2008
wnt1	roof plate spinal cord region	Fig. 3 from Bonner et al., 2008
zic2a	diencephalon hindbrain midbrain neural tube optic stalk telencephalon	Fig. 6 from Nyholm et al., 2007

Phenotype

Phenotype resulting from MO1-tcf7

Phenotype	Fish	Figures
brain wholly posteriorized, abnormal	WT + MO1-tcf7	Fig. 6 from Nyholm et al., 2007
cell population proliferation occurrence, abnormal	AB + MO1-tcf7	Fig. 3 from Bonner et al., 2008
midbrain morphology, abnormal	WT + MO1-tcf7	Fig. 6 from Nyholm et al., 2007
pectoral fin decreased size, abnormal	WT + MO1-tcf7	Fig. 3 from Nagayoshi et al., 2008
pectoral fin undulate, abnormal	WT + MO1-tcf7	Fig. 3 from Nagayoshi et al., 2008

Phenotype of all Fish created by or utilizing MO1-tcf7

Phenotype	Fish	Conditions	Figures
cell population proliferation occurrence, abnormal	AB + MO1-tcf7	standard conditions	Fig. 3 from Bonner et al., 2008
pectoral fin decreased size, abnormal	WT + MO1-tcf7	standard conditions	Fig. 3 from Nagayoshi et al., 2008
brain wholly posteriorized, abnormal	WT + MO1-tcf7	standard conditions	Fig. 6 from Nyholm et al., 2007
pectoral fin undulate, abnormal	WT + MO1-tcf7	standard conditions	Fig. 3 from Nagayoshi et al., 2008
midbrain morphology, abnormal	WT + MO1-tcf7	standard conditions	Fig. 6 from Nyholm et al., 2007
posterior lateral line truncated, abnormal	lef1^nl2/nl2 + MO1-tcf7 + MO4-tp53 (WIK/AB)	standard conditions	Fig. 4 from McGraw et al., 2011
pectoral fin hypoplastic, abnormal	lef1^nl2/nl2 + MO1-tcf7 + MO4-tp53 (WIK/AB)	standard conditions	Fig. S5 from McGraw et al., 2011
median fin fold decreased size, abnormal	lef1^nl2/nl2 + MO1-tcf7 + MO4-tp53 (WIK/AB)	standard conditions	Fig. 4 from McGraw et al., 2011

Citations