Morpholino
MO2-ptf1a
- ID
- ZDB-MRPHLNO-070531-7
- Name
- MO2-ptf1a
- Previous Names
-
- Ptf1a-MOa (1)
- Target
- Sequence
-
5' - AGTGTCCATTTTTTGTGCTGTGTTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ptf1a
No data available
Phenotype
Phenotype resulting from MO2-ptf1a
| Phenotype | Fish | Figures |
|---|---|---|
| exocrine pancreas aplastic, abnormal | AB + MO2-ptf1a |
Fig. 3  ,
Fig. 4
from Jiang et al., 2008 |
| exocrine pancreas development disrupted, abnormal | AB + MO2-ptf1a |
Fig. 3 ,
Fig. 4
from Jiang et al., 2008 |
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO2-ptf1a
1 - 3 of 3
Citations
- Dong, P.D., Provost, E., Leach, S.D., and Stainier, D.Y. (2008) Graded levels of Ptf1a differentially regulate endocrine and exocrine fates in the developing pancreas. Genes & Development. 22(11):1445-1450
- Jiang, Z., Song, J., Qi, F., Xiao, A., An, X., Liu, N.A., Zhu, Z., Zhang, B., and Lin, S. (2008) Exdpf is a key regulator of exocrine pancreas development controlled by retinoic acid and ptf1a in zebrafish. PLoS Biology. 6(11):e293
- Pauls, S., Zecchin, E., Tiso, N., Bortolussi, M., and Argenton, F. (2007) Function and regulation of zebrafish nkx2.2a during development of pancreatic islet and ducts. Developmental Biology. 304(2):875-890
- Pisharath, H., Rhee, J.M., Swanson, M.A., Leach, S.D., and Parsons, M.J. (2007) Targeted ablation of beta cells in the embryonic zebrafish pancreas using E. coli nitroreductase. Mechanisms of Development. 124(3):218-229
- Zecchin, E., Mavropoulos, A., Devos, N., Filippi, A., Tiso, N., Meyer, D., Peers, B., Bortolussi, M., Argenton, F. (2004) Evolutionary conserved role of ptf1a in the specification of exocrine pancreatic fates. Developmental Biology. 268(1):174-184
1 - 5 of 5
Show