header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070530-1
Morpholino Name: MO1-wt1a
Target: wt1a (1)
Sequence:
5' - TGAGGTCACGAACATCAGAACCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-wt1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-wt1a No data available
PHENOTYPE
Phenotype resulting from MO1-wt1a
Phenotype of all Fish created by or utilizing MO1-wt1a
Genome Resources:
CITATIONS (2)