Morpholino

MO5-dlx4b

ID

ZDB-MRPHLNO-070504-3

Name

MO5-dlx4b

Previous Names

dlx7-2 (1)

Target

dlx4b (1)

Sequence

5' - TCAGACATGAAACTCATAGACATCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO5-dlx4b

Expressed Gene	Anatomy	Figures
anxa5b	olfactory placode	Fig. 4 from Solomon et al., 2002
dlx3b	olfactory field olfactory placode otic placode otic vesicle pharyngeal arch	Fig. 6 from Solomon et al., 2002
dlx4b	olfactory field otic placode	Fig. 6 from Solomon et al., 2002
eya1	anterior lateral line placode olfactory placode otic vesicle posterior lateral line placode somite	Fig. 4 from Solomon et al., 2002
pax2a	midbrain hindbrain boundary neural keel otic placode pronephric mesoderm	Fig. 5 from Solomon et al., 2002
pax8	otic placode pronephric mesoderm	Fig. 5 from Solomon et al., 2002

Phenotype

Phenotype resulting from MO5-dlx4b

No data available

Phenotype of all Fish created by or utilizing MO5-dlx4b

Phenotype	Fish	Conditions	Figures
otic vesicle development process quality, abnormal	WT + MO2-dlx3b + MO5-dlx4b	standard conditions	Fig. 4 from Solomon et al., 2002
olfactory placode development process quality, abnormal	WT + MO2-dlx3b + MO5-dlx4b	standard conditions	Fig. 4 from Solomon et al., 2002
otolith absent, abnormal	WT + MO2-dlx3b + MO5-dlx4b	standard conditions	Fig. 2 from Solomon et al., 2002
otic vesicle decreased size, abnormal	WT + MO2-dlx3b + MO5-dlx4b	standard conditions	Fig. 2 from Solomon et al., 2002
olfactory placode formation arrested, abnormal	WT + MO2-dlx3b + MO5-dlx4b	standard conditions	Fig. 5 from Solomon et al., 2002
olfactory placode formation arrested, abnormal	WT + MO5-dlx3b + MO5-dlx4b	standard conditions	Fig. 5 from Solomon et al., 2002
otic vesicle decreased size, abnormal	WT + MO5-dlx3b + MO5-dlx4b	standard conditions	Fig. 2 from Solomon et al., 2002
otic vesicle development process quality, abnormal	WT + MO5-dlx3b + MO5-dlx4b	standard conditions	Fig. 4 from Solomon et al., 2002
olfactory placode development process quality, abnormal	WT + MO5-dlx3b + MO5-dlx4b	standard conditions	Fig. 4 from Solomon et al., 2002
post-vent region wholly ventralized, abnormal	WT + MO5-dlx3b + MO5-dlx4b	standard conditions	Fig. 2 from Esterberg et al., 2009
inner ear lacks all parts of type otolith, abnormal	WT + MO5-dlx3b + MO5-dlx4b	standard conditions	Fig. 9 from Esterberg et al., 2009
otolith absent, abnormal	WT + MO5-dlx3b + MO5-dlx4b	standard conditions	Fig. 2 from Solomon et al., 2002
intermediate cell mass of mesoderm increased size, abnormal	WT + MO5-dlx3b + MO5-dlx4b	standard conditions	Fig. 2 from Esterberg et al., 2009
inner ear lacks all parts of type otolith, abnormal	WT + MO1-bmper + MO5-dlx3b + MO5-dlx4b	standard conditions	Fig. 9 from Esterberg et al., 2009
intermediate cell mass of mesoderm increased size, abnormal	WT + MO1-chrd + MO5-dlx3b + MO5-dlx4b	standard conditions	Fig. 2 from Esterberg et al., 2009
post-vent region wholly ventralized, abnormal	WT + MO1-chrd + MO5-dlx3b + MO5-dlx4b	standard conditions	Fig. 2 from Esterberg et al., 2009

Citations