Morpholino

MO1-cxcr4a

ID
ZDB-MRPHLNO-070427-1
Name
MO1-cxcr4a
Previous Names
  • cxcr4a MORPH 1667 (1)
Target
Sequence
5' - AGACGATGTGTTCGTAATAAGCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cxcr4a
No data available
Phenotype
Phenotype resulting from MO1-cxcr4a
Phenotype Fish Figures
cell migration involved in gastrulation disrupted, abnormal ha01Tg + MO1-cxcr4a Fig. 5 from Schmid et al., 2013
determination of left/right asymmetry in lateral mesoderm decreased occurrence, abnormal TU + MO1-cxcr4a Fig. 1 with image from Liu et al., 2019
determination of left/right asymmetry in lateral mesoderm process quality, abnormal TU + MO1-cxcr4a Fig. 1 with image from Liu et al., 2019
determination of liver left/right asymmetry decreased occurrence, abnormal TU + MO1-cxcr4a Fig. 1 with image from Liu et al., 2019
determination of liver left/right asymmetry process quality, abnormal TU + MO1-cxcr4a Fig. 1 with image from Liu et al., 2019
dorsal convergence delayed, abnormal WT + MO1-cxcr4a Fig. S7 from Nair et al., 2008
dorsal convergence disrupted, abnormal WT + MO1-cxcr4a Fig. 5Fig. 6 from Schmid et al., 2013
endodermal cell displaced, abnormal ha01Tg + MO1-cxcr4a Fig. 2 with image from Malhotra et al., 2018
endodermal cell displaced to margin, abnormal WT + MO1-cxcr4a Fig. 1 from Nair et al., 2008
endodermal cell mislocalised anteriorly, abnormal WT + MO1-cxcr4a Fig. 6Fig. S5 from Schmid et al., 2013
Fig. 1 from Nair et al., 2008
heart looping decreased occurrence, abnormal TU + MO1-cxcr4a Fig. 1 with image from Liu et al., 2019
heart looping process quality, abnormal TU + MO1-cxcr4a Fig. 1 with image from Liu et al., 2019
intestine duplicated, abnormal WT + MO1-cxcr4a Fig. 1 from Nair et al., 2008
lateral dorsal aorta malformed, abnormal la116Tg + MO1-cxcr4a Fig. S7 with image from Siekmann et al., 2009
liver duplicated, abnormal s854Tg + MO1-cxcr4a Fig. 1 from Nair et al., 2008
pancreas duplicated, abnormal s854Tg + MO1-cxcr4a Fig. 1 from Nair et al., 2008
somite cellular quality, abnormal WT + MO1-cxcr4a Fig. 6 from Hollway et al., 2007
vasculogenesis process quality, abnormal la116Tg + MO1-cxcr4a Fig. S7 with image from Siekmann et al., 2009
Phenotype of all Fish created by or utilizing MO1-cxcr4a
Phenotype Fish Conditions Figures
heart looping decreased occurrence, abnormal TU + MO1-cxcr4a standard conditions Fig. 1 with image from Liu et al., 2019
determination of liver left/right asymmetry process quality, abnormal TU + MO1-cxcr4a standard conditions Fig. 1 with image from Liu et al., 2019
heart looping process quality, abnormal TU + MO1-cxcr4a standard conditions Fig. 1 with image from Liu et al., 2019
determination of left/right asymmetry in lateral mesoderm process quality, abnormal TU + MO1-cxcr4a standard conditions Fig. 1 with image from Liu et al., 2019
determination of left/right asymmetry in lateral mesoderm decreased occurrence, abnormal TU + MO1-cxcr4a standard conditions Fig. 1 with image from Liu et al., 2019
determination of liver left/right asymmetry decreased occurrence, abnormal TU + MO1-cxcr4a standard conditions Fig. 1 with image from Liu et al., 2019
intestine duplicated, abnormal WT + MO1-cxcr4a standard conditions Fig. 1 from Nair et al., 2008
dorsal convergence delayed, abnormal WT + MO1-cxcr4a standard conditions Fig. S7 from Nair et al., 2008
endodermal cell displaced to margin, abnormal WT + MO1-cxcr4a standard conditions Fig. 1 from Nair et al., 2008
endodermal cell mislocalised anteriorly, abnormal WT + MO1-cxcr4a standard conditions Fig. 6Fig. S5 from Schmid et al., 2013
Fig. 1 from Nair et al., 2008
somite cellular quality, abnormal WT + MO1-cxcr4a standard conditions Fig. 6 from Hollway et al., 2007
dorsal convergence disrupted, abnormal WT + MO1-cxcr4a standard conditions Fig. 6 from Schmid et al., 2013
cell migration involved in gastrulation disrupted, abnormal ha01Tg + MO1-cxcr4a standard conditions Fig. 5 from Schmid et al., 2013
dorsal convergence disrupted, abnormal ha01Tg + MO1-cxcr4a standard conditions Fig. 5 from Schmid et al., 2013
endodermal cell displaced, abnormal ha01Tg + MO1-cxcr4a control Fig. 2 with image from Malhotra et al., 2018
lateral dorsal aorta malformed, abnormal la116Tg + MO1-cxcr4a standard conditions Fig. S7 with image from Siekmann et al., 2009
vasculogenesis process quality, abnormal la116Tg + MO1-cxcr4a standard conditions Fig. S7 with image from Siekmann et al., 2009
pancreas duplicated, abnormal s854Tg + MO1-cxcr4a standard conditions Fig. 1 from Nair et al., 2008
liver duplicated, abnormal s854Tg + MO1-cxcr4a standard conditions Fig. 1 from Nair et al., 2008
somite cellular quality, abnormal WT + MO1-cxcr4a + MO2-cxcr4b standard conditions Fig. 6 from Hollway et al., 2007
endodermal cell displaced, abnormal ha01Tg + MO1-cxcr4a + MO5-cxcl12b control Fig. 1 with image from Malhotra et al., 2018
Citations