Morpholino

MO1-agrn

ID
ZDB-MRPHLNO-070411-1
Name
MO1-agrn
Previous Names
  • zfAgrinLG1-MO (1)
Target
Sequence
5' - AGAGTTGTACACCTACCAGAGAAAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-agrn
Expressed Gene Anatomy Figures
agrn Fig. 3 from Kim et al., 2007
alcama Fig. 7 from Kim et al., 2007
efna5a Fig. 4 from Kim et al., 2007
efna5b Fig. 4 from Kim et al., 2007
pax2a Fig. 4 from Kim et al., 2007
Phenotype
Phenotype resulting from MO1-agrn
Phenotype Fish Figures
axonal defasciculation increased occurrence, abnormal WT + MO1-agrn Fig. 8 from Kim et al., 2007
branchiomotor neuron axon guidance disrupted, abnormal rw0Tg + MO1-agrn Fig. 7 from Kim et al., 2007
CaP motoneuron axon decreased length, abnormal WT + MO1-agrn Fig. 6 from Kim et al., 2007
cranial nerve IX axon decreased length, abnormal WT + MO1-agrn Fig. 7 from Kim et al., 2007
cranial nerve V axon decreased length, abnormal WT + MO1-agrn Fig. 7,  Fig. 8 from Kim et al., 2007
cranial nerve V axon defasciculated, abnormal WT + MO1-agrn Fig. 7 from Kim et al., 2007
cranial nerve VI axon decreased length, abnormal WT + MO1-agrn Fig. 7 from Kim et al., 2007
cranial nerve X axon decreased length, abnormal WT + MO1-agrn Fig. 7 from Kim et al., 2007
eye decreased size, abnormal WT + MO1-agrn Fig. 3 from Kim et al., 2007
facial ganglion decreased size, abnormal rw0Tg + MO1-agrn Fig. 7 from Kim et al., 2007
heart contraction decreased rate, abnormal WT + MO1-agrn text only from Kim et al., 2007
lateral line nerve axon decreased length, abnormal WT + MO1-agrn Fig. 8 from Kim et al., 2007
midbrain hindbrain boundary aplastic, abnormal WT + MO1-agrn Fig. 3 from Kim et al., 2007
midbrain-hindbrain boundary development disrupted, abnormal WT + MO1-agrn Fig. 3 from Kim et al., 2007
motor neuron axon guidance disrupted, abnormal WT + MO1-agrn Fig. 6 from Kim et al., 2007
otic vesicle decreased size, abnormal WT + MO1-agrn Fig. 3 from Kim et al., 2007
pericardium edematous, abnormal WT + MO1-agrn Fig. 3,  text only from Kim et al., 2007
pharyngeal pouch morphology, abnormal WT + MO1-agrn Fig. 7 from Kim et al., 2007
post-anal tail morphogenesis disrupted, abnormal WT + MO1-agrn Fig. 3 from Kim et al., 2007
post-vent region curvature, abnormal WT + MO1-agrn Fig. 3 from Kim et al., 2007
post-vent region decreased length, abnormal WT + MO1-agrn Fig. 3,  Fig. 5 from Kim et al., 2007
receptor clustering disrupted, abnormal WT + MO1-agrn Fig. 10,  Fig. 11 from Kim et al., 2007
Rohon-Beard neuron axon decreased amount, abnormal WT + MO1-agrn Fig. 8 from Kim et al., 2007
Rohon-Beard neuron axon decreased length, abnormal WT + MO1-agrn Fig. 8 from Kim et al., 2007
sensory neuron morphology, abnormal WT + MO1-agrn Fig. 8 from Kim et al., 2007
somite decreased size, abnormal WT + MO1-agrn Fig. 5 from Kim et al., 2007
somite morphology, abnormal WT + MO1-agrn Fig. 3,  Fig. 6 from Kim et al., 2007
somite border morphology, abnormal WT + MO1-agrn Fig. 11 from Kim et al., 2007
trigeminal motor nucleus decreased size, abnormal rw0Tg + MO1-agrn Fig. 7 from Kim et al., 2007
whole organism decreased length, abnormal WT + MO1-agrn Fig. 5 from Kim et al., 2007
whole organism immobile, abnormal WT + MO1-agrn text only from Kim et al., 2007
Phenotype of all Fish created by or utilizing MO1-agrn
Phenotype Fish Conditions Figures
eye decreased size, abnormal WT + MO1-agrn standard conditions Fig. 3 from Kim et al., 2007
CaP motoneuron axon decreased length, abnormal WT + MO1-agrn standard conditions Fig. 6 from Kim et al., 2007
cranial nerve X axon decreased length, abnormal WT + MO1-agrn standard conditions Fig. 7 from Kim et al., 2007
pericardium edematous, abnormal WT + MO1-agrn standard conditions Fig. 3,  text only from Kim et al., 2007
otic vesicle decreased size, abnormal WT + MO1-agrn standard conditions Fig. 3 from Kim et al., 2007
somite decreased size, abnormal WT + MO1-agrn standard conditions Fig. 5 from Kim et al., 2007
post-anal tail morphogenesis disrupted, abnormal WT + MO1-agrn standard conditions Fig. 3 from Kim et al., 2007
lateral line nerve axon decreased length, abnormal WT + MO1-agrn standard conditions Fig. 8 from Kim et al., 2007
Rohon-Beard neuron axon decreased length, abnormal WT + MO1-agrn standard conditions Fig. 8 from Kim et al., 2007
heart contraction decreased rate, abnormal WT + MO1-agrn standard conditions text only from Kim et al., 2007
receptor clustering disrupted, abnormal WT + MO1-agrn standard conditions Fig. 10,  Fig. 11 from Kim et al., 2007
somite border morphology, abnormal WT + MO1-agrn standard conditions Fig. 11 from Kim et al., 2007
midbrain hindbrain boundary aplastic, abnormal WT + MO1-agrn standard conditions Fig. 3 from Kim et al., 2007
cranial nerve V axon defasciculated, abnormal WT + MO1-agrn standard conditions Fig. 7 from Kim et al., 2007
cranial nerve VI axon decreased length, abnormal WT + MO1-agrn standard conditions Fig. 7 from Kim et al., 2007
whole organism decreased length, abnormal WT + MO1-agrn standard conditions Fig. 5 from Kim et al., 2007
axonal defasciculation increased occurrence, abnormal WT + MO1-agrn standard conditions Fig. 8 from Kim et al., 2007
sensory neuron morphology, abnormal WT + MO1-agrn standard conditions Fig. 8 from Kim et al., 2007
motor neuron axon guidance disrupted, abnormal WT + MO1-agrn standard conditions Fig. 6 from Kim et al., 2007
midbrain-hindbrain boundary development disrupted, abnormal WT + MO1-agrn standard conditions Fig. 3 from Kim et al., 2007
Rohon-Beard neuron axon decreased amount, abnormal WT + MO1-agrn standard conditions Fig. 8 from Kim et al., 2007
post-vent region curvature, abnormal WT + MO1-agrn standard conditions Fig. 3 from Kim et al., 2007
cranial nerve IX axon decreased length, abnormal WT + MO1-agrn standard conditions Fig. 7 from Kim et al., 2007
pharyngeal pouch morphology, abnormal WT + MO1-agrn standard conditions Fig. 7 from Kim et al., 2007
cranial nerve V axon decreased length, abnormal WT + MO1-agrn standard conditions Fig. 7,  Fig. 8 from Kim et al., 2007
whole organism immobile, abnormal WT + MO1-agrn standard conditions text only from Kim et al., 2007
somite morphology, abnormal WT + MO1-agrn standard conditions Fig. 3,  Fig. 6 from Kim et al., 2007
post-vent region decreased length, abnormal WT + MO1-agrn standard conditions Fig. 3,  Fig. 5 from Kim et al., 2007
facial ganglion decreased size, abnormal rw0Tg + MO1-agrn standard conditions Fig. 7 from Kim et al., 2007
branchiomotor neuron axon guidance disrupted, abnormal rw0Tg + MO1-agrn standard conditions Fig. 7 from Kim et al., 2007
trigeminal motor nucleus decreased size, abnormal rw0Tg + MO1-agrn standard conditions Fig. 7 from Kim et al., 2007
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.