Morpholino

MO2-cyp26c1

ID
ZDB-MRPHLNO-070410-8
Name
MO2-cyp26c1
Previous Names
None
Target
Sequence
5' - GGAACCCTGTCACAACATAACAGAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Targets intron-1–exon-2 junction. Morpholino toxic at higher concentrations.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-cyp26c1
No data available
Phenotype
Phenotype resulting from MO2-cyp26c1
No data available
Phenotype of all Fish created by or utilizing MO2-cyp26c1
Phenotype Fish Conditions Figures
whole organism mmp9 expression increased amount, abnormal WT + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 5 with image from Rydeen et al., 2016
whole organism fgf8a expression decreased amount, abnormal WT + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 4 with image from Rydeen et al., 2016
heart fgf8a expression decreased amount, abnormal WT + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 4 with image from Rydeen et al., 2016
heart mmp9 expression increased amount, abnormal WT + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 5 with image from Rydeen et al., 2016
cardiac ventricle has fewer parts of type cardiac muscle cell, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
cardiac ventricle cardiac ventricle morphogenesis decreased process quality, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 1 with imageFig. 5 with image from Rydeen et al., 2016
ventricular myocardium cardiac muscle cell mislocalised, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
cardiac ventricle decreased size, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 1 with image from Rydeen et al., 2016
cardiac ventricle has fewer parts of type cardiac muscle cell, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 5 with image from Rydeen et al., 2016
cardiac ventricle has number of cardiac muscle cell, ameliorated f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 chemical treatment by environment: 3-(N-HYDROXYCARBOXAMIDO)-2-ISOBUTYLPROPANOYL-TRP-METHYLAMIDE Fig. 5 with image from Rydeen et al., 2016
cardiac ventricle cardiac ventricle morphogenesis decreased process quality, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
cardiac muscle cell external to heart, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
cardiac ventricle cardiac ventricle morphogenesis process quality, ameliorated f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 chemical treatment by environment: 3-(N-HYDROXYCARBOXAMIDO)-2-ISOBUTYLPROPANOYL-TRP-METHYLAMIDE Fig. 5 with image from Rydeen et al., 2016
whole organism myh7 expression decreased amount, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 1 with image from Rydeen et al., 2016
whole organism myl7 expression decreased amount, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 1 with image from Rydeen et al., 2016
presumptive bulbus arteriosus ripply3 expression increased amount, abnormal fb7Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO4-tp53 + MO5-cyp26a1 standard conditions Fig 7 with image from Song et al., 2019
cell migration involved in heart formation process quality, abnormal fb7Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 2 with image from Rydeen et al., 2016
cardiac ventricle cell migration involved in heart formation decreased process quality, abnormal fb9Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 2 with image from Rydeen et al., 2016
aortic arch has extra parts of type blood vessel endothelial cell, abnormal fb9Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 2 with image from Rydeen et al., 2016
bulbus arteriosus outflow tract morphogenesis decreased process quality, abnormal sd22Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
bulbus arteriosus outflow tract morphogenesis decreased process quality, abnormal sd22Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 1 with imageFig. 5 with image from Rydeen et al., 2016
bulbus arteriosus outflow tract morphogenesis process quality, ameliorated sd22Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 chemical treatment by environment: 3-(N-HYDROXYCARBOXAMIDO)-2-ISOBUTYLPROPANOYL-TRP-METHYLAMIDE Fig. 5 with image from Rydeen et al., 2016
cardiac muscle cell external to heart, abnormal sd22Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 1 with image from Rydeen et al., 2016
cardiac muscle cell mislocalised, abnormal sd22Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 1 with image from Rydeen et al., 2016
ventricular myocardium cell-cell junction ab1-ctnnb labeling spatial pattern, abnormal twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
ventricular myocardium bicellular tight junction ab1-tjp1 labeling spatial pattern, abnormal twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
ventricular myocardium cardiac muscle cell mislocalised, abnormal twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
cardiac ventricle cardiac ventricle morphogenesis decreased process quality, abnormal twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
cardiac ventricle cardiac muscle cell circular, abnormal twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
cardiac ventricle establishment of cell polarity decreased process quality, abnormal twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
ventricular myocardium increased distance ventricular endocardium, abnormal ci5Tg; twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
cardiac ventricle cardiac ventricle morphogenesis decreased process quality, abnormal ci5Tg; twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
cardiac ventricle cell migration involved in heart formation decreased process quality, abnormal fb9Tg; ubs1Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 2 with image from Rydeen et al., 2016
aortic arch 4 has extra parts of type blood vessel endothelial cell, abnormal fb9Tg; ubs1Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 2 with image from Rydeen et al., 2016
aortic arch 3 has extra parts of type blood vessel endothelial cell, abnormal fb9Tg; ubs1Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 2 with image from Rydeen et al., 2016
cardiac ventricle has fewer parts of type cardiac muscle cell, abnormal f2Tg; pd3Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
ventricular myocardium cardiac muscle cell mislocalised, abnormal f2Tg; pd3Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
cardiac ventricle has number of cardiac muscle cell, ameliorated f2Tg; pd3Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
cardiac muscle cell external to heart, abnormal f2Tg; pd3Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
cardiac ventricle cardiac ventricle morphogenesis decreased process quality, abnormal f2Tg; pd3Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
bulbus arteriosus outflow tract morphogenesis process quality, ameliorated pd3Tg; sd22Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
Citations