Morpholino

MO1-dcc

ID
ZDB-MRPHLNO-070328-5
Name
MO1-dcc
Previous Names
None
Target
Sequence
5' - GAATATCTCCAGTGACGCAGCCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dcc
No data available
Phenotype
Phenotype resulting from MO1-dcc
Phenotype Fish Figures
branching involved in lymph vessel morphogenesis process quality, abnormal y1Tg/+ + MO1-dcc Fig. 4 with image from Lim et al., 2011
commissural neuron axon guidance process quality, abnormal WT + MO1-dcc Fig. 4 with image from Sun et al., 2016
CoPA axon extension involved in axon guidance decreased process quality, abnormal WT + MO1-dcc Fig. 4 with image from Sun et al., 2016
CoPA neuron projection misrouted, abnormal WT + MO1-dcc Fig. 4 with image from Sun et al., 2016
dendrite development disrupted, abnormal rw0Tg + MO1-dcc Fig. 3 from Suli et al., 2006
dorso-rostral cluster axon extension process quality, abnormal b1204Tg + MO1-dcc Fig. 3 with imageFig. 4 with imageFig. 5 with image from Gao et al., 2012
Fig. 4 from Zhang et al., 2012
dorso-rostral cluster neuron projection mislocalised, abnormal b1204Tg + MO1-dcc Fig. 4 from Zhang et al., 2012
dorso-rostral cluster neuron projection mislocalised dorsally, abnormal b1204Tg + MO1-dcc Fig. 3 with imageFig. 4 with imageFig. 5 with image from Gao et al., 2012
dorso-rostral cluster neuron projection misrouted, abnormal b1204Tg + MO1-dcc Fig. 4 from Zhang et al., 2012
dorso-rostral cluster neuron projection multiple, abnormal b1204Tg + MO1-dcc Fig. 4 with image from Gao et al., 2012
dorso-rostral cluster neuron projection physical object quality, abnormal b1204Tg + MO1-dcc Fig. 3 with imageFig. 4 with imageFig. 5 with image from Gao et al., 2012
horizontal myoseptum lacks parts or has fewer parts of type motor neuron axon, abnormal ml2Tg + MO1-dcc Fig. 6 with image from Lim et al., 2011
horizontal myoseptum lacks parts or has fewer parts of type RoP motor neuron axon, abnormal ml2Tg + MO1-dcc Fig. 6 with image from Lim et al., 2011
lymph vessel development process quality, abnormal y1Tg/+ + MO1-dcc Fig. 4 with imageFig. S1 with image from Lim et al., 2011
olfactory bulb axon guidance disrupted, abnormal p200Tg; p201Tg + MO1-dcc Fig. 3 from Lakhina et al., 2012
olfactory receptor cell axon attached to anterior commissure, abnormal p200Tg; p201Tg + MO1-dcc Fig. 3 from Lakhina et al., 2012
olfactory receptor cell axon attached to lateral protoglomerulus 1, abnormal p200Tg; p201Tg + MO1-dcc Fig. 3 from Lakhina et al., 2012
olfactory receptor cell axon attached to lateral protoglomerulus 2, abnormal p200Tg; p201Tg + MO1-dcc Fig. 3 from Lakhina et al., 2012
olfactory receptor cell axon position, abnormal p200Tg; p201Tg + MO1-dcc Fig. 3 from Lakhina et al., 2012
parachordal vessel immature, abnormal y1Tg/+ + MO1-dcc Fig. 4 with image from Lim et al., 2011
parachordal vessel venous endothelial cell migration involved in lymph vessel development arrested, abnormal y1Tg/+ + MO1-dcc Fig. 4 with image from Lim et al., 2011
thoracic duct aplastic, abnormal y1Tg/+ + MO1-dcc Fig. S1 with image from Lim et al., 2011
VaP motor neuron axon protruding into muscle pioneer, abnormal WT + MO1-dcc Fig. 5 with image from Hale et al., 2011
Phenotype of all Fish created by or utilizing MO1-dcc
Phenotype Fish Conditions Figures
VaP motor neuron axon protruding into muscle pioneer, abnormal WT + MO1-dcc standard conditions Fig. 5 with image from Hale et al., 2011
commissural neuron axon guidance process quality, abnormal WT + MO1-dcc standard conditions Fig. 4 with image from Sun et al., 2016
CoPA axon extension involved in axon guidance decreased process quality, abnormal WT + MO1-dcc standard conditions Fig. 4 with image from Sun et al., 2016
CoPA neuron projection misrouted, abnormal WT + MO1-dcc standard conditions Fig. 4 with image from Sun et al., 2016
lymph vessel development process quality, abnormal y1Tg/+ + MO1-dcc standard conditions Fig. 4 with imageFig. S1 with image from Lim et al., 2011
branching involved in lymph vessel morphogenesis process quality, abnormal y1Tg/+ + MO1-dcc standard conditions Fig. 4 with image from Lim et al., 2011
parachordal vessel immature, abnormal y1Tg/+ + MO1-dcc standard conditions Fig. 4 with image from Lim et al., 2011
thoracic duct aplastic, abnormal y1Tg/+ + MO1-dcc standard conditions Fig. S1 with image from Lim et al., 2011
parachordal vessel venous endothelial cell migration involved in lymph vessel development arrested, abnormal y1Tg/+ + MO1-dcc standard conditions Fig. 4 with image from Lim et al., 2011
dorso-rostral cluster neuron projection mislocalised, abnormal b1204Tg + MO1-dcc standard conditions Fig. 4 from Zhang et al., 2012
dorso-rostral cluster neuron projection physical object quality, abnormal b1204Tg + MO1-dcc standard conditions Fig. 3 with imageFig. 4 with imageFig. 5 with image from Gao et al., 2012
dorso-rostral cluster neuron projection multiple, abnormal b1204Tg + MO1-dcc standard conditions Fig. 4 with image from Gao et al., 2012
dorso-rostral cluster neuron projection mislocalised dorsally, abnormal b1204Tg + MO1-dcc standard conditions Fig. 3 with imageFig. 4 with imageFig. 5 with image from Gao et al., 2012
dorso-rostral cluster axon extension process quality, abnormal b1204Tg + MO1-dcc standard conditions Fig. 3 with imageFig. 4 with imageFig. 5 with image from Gao et al., 2012
Fig. 4 from Zhang et al., 2012
dorso-rostral cluster neuron projection misrouted, abnormal b1204Tg + MO1-dcc standard conditions Fig. 4 from Zhang et al., 2012
horizontal myoseptum lacks parts or has fewer parts of type RoP motor neuron axon, abnormal ml2Tg + MO1-dcc standard conditions Fig. 6 with image from Lim et al., 2011
horizontal myoseptum lacks parts or has fewer parts of type motor neuron axon, abnormal ml2Tg + MO1-dcc standard conditions Fig. 6 with image from Lim et al., 2011
dendrite development disrupted, abnormal rw0Tg + MO1-dcc standard conditions Fig. 3 from Suli et al., 2006
olfactory receptor cell axon attached to lateral protoglomerulus 2, abnormal p200Tg; p201Tg + MO1-dcc standard conditions Fig. 3 from Lakhina et al., 2012
olfactory receptor cell axon attached to lateral protoglomerulus 1, abnormal p200Tg; p201Tg + MO1-dcc standard conditions Fig. 3 from Lakhina et al., 2012
olfactory receptor cell axon position, abnormal p200Tg; p201Tg + MO1-dcc standard conditions Fig. 3 from Lakhina et al., 2012
olfactory bulb axon guidance disrupted, abnormal p200Tg; p201Tg + MO1-dcc standard conditions Fig. 3 from Lakhina et al., 2012
olfactory receptor cell axon attached to anterior commissure, abnormal p200Tg; p201Tg + MO1-dcc standard conditions Fig. 3 from Lakhina et al., 2012
CoPA neuron projection misrouted, abnormal fzd3arw689/rw689 + MO1-dcc standard conditions Fig. 4 with image from Sun et al., 2016
CoPA anterior/posterior axon guidance decreased process quality, abnormal fzd3arw689/rw689 + MO1-dcc standard conditions Fig. 4 with image from Sun et al., 2016
commissural neuron axon guidance process quality, abnormal fzd3arw689/rw689 + MO1-dcc standard conditions Fig. 4 with image from Sun et al., 2016
axonal fasciculation decreased occurrence, abnormal robo2ti272z/ti272z + MO1-dcc standard conditions Fig. 5 from Kastenhuber et al., 2009
CoPA neuron projection misrouted, abnormal scribrw468/rw468 + MO1-dcc standard conditions Fig. 4 with image from Sun et al., 2016
CoPA anterior/posterior axon guidance decreased process quality, abnormal scribrw468/rw468 + MO1-dcc standard conditions Fig. 4 with image from Sun et al., 2016
commissural neuron axon guidance process quality, abnormal scribrw468/rw468 + MO1-dcc standard conditions Fig. 4 with image from Sun et al., 2016
parachordal vessel immature, abnormal y1Tg/+ + MO1-dcc + MO3-plcg1 standard conditions Fig. 4 with image from Lim et al., 2011
parachordal vessel venous endothelial cell migration involved in lymph vessel development arrested, abnormal y1Tg/+ + MO1-dcc + MO3-plcg1 standard conditions Fig. 4 with image from Lim et al., 2011
branching involved in lymph vessel morphogenesis process quality, abnormal y1Tg/+ + MO1-dcc + MO3-plcg1 standard conditions Fig. 4 with image from Lim et al., 2011
dorso-rostral cluster neuron projection mislocalised dorsally, abnormal b1204Tg + MO1-dcc + MO2-neo1a standard conditions Fig. 5 with image from Gao et al., 2012
dorso-rostral cluster axon extension process quality, abnormal b1204Tg + MO1-dcc + MO2-neo1a standard conditions Fig. 5 with image from Gao et al., 2012
dorso-rostral cluster neuron projection mislocalised dorsally, abnormal b1204Tg + MO1-dcc + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 5 with image from Gao et al., 2012
dorso-rostral cluster neuron projection physical object quality, abnormal b1204Tg + MO1-dcc + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 5 with image from Gao et al., 2012
dorso-rostral cluster axon extension process quality, abnormal b1204Tg + MO1-dcc + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 5 with image from Gao et al., 2012
olfactory receptor cell axon detached from lateral protoglomerulus 1, abnormal p201Tg; p202Tg + MO1-dcc standard conditions Fig. 7 from Lakhina et al., 2012
olfactory receptor cell axon attached to medial protoglomerulus, abnormal p201Tg; p202Tg + MO1-dcc standard conditions Fig. 4 from Lakhina et al., 2012
olfactory receptor cell axon attached to dorsal zone olfactory bulb, abnormal p201Tg; p202Tg + MO1-dcc standard conditions Fig. 4 from Lakhina et al., 2012
olfactory bulb axon guidance disrupted, abnormal p201Tg; p202Tg + MO1-dcc standard conditions Fig. 4Fig. 7 from Lakhina et al., 2012
olfactory receptor cell axon position, abnormal p201Tg; p202Tg + MO1-dcc standard conditions Fig. 4Fig. 7 from Lakhina et al., 2012
olfactory receptor cell axon attached to lateral zone olfactory bulb, abnormal p201Tg; p202Tg + MO1-dcc standard conditions Fig. 7 from Lakhina et al., 2012
olfactory receptor cell axon posterior to olfactory bulb, abnormal p201Tg; p202Tg + MO1-dcc standard conditions Fig. 7 from Lakhina et al., 2012
Citations