header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070327-2
Morpholino Name: MO1-dlx2a
Target: dlx2a (1)
Sequence:
5' - TGAGGCTGTCAAAAACTCCAGTCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking morpholino.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-dlx2a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-dlx2a No data available
PHENOTYPE
Phenotype resulting from MO1-dlx2a
No data available

Phenotype of all Fish created by or utilizing MO1-dlx2a
Genome Resources:
CITATIONS (3)