header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070313-2
Morpholino Name: MO2-otpb
Target: otpb (1)
Sequence:
5' - AGAGGTCGGCATGAGAGAGCATTGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-otpb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-otpb
Expressed Gene Anatomy Figures
avp Fig. 5 with image from Eaton et al., 2008
dlx2a Fig. 4 from Eaton et al., 2007
nkx2.2a Fig. 4 from Eaton et al., 2007
nkx2.4b Fig. 4 from Eaton et al., 2007
otpb Fig. 3Fig. 5 from Eaton et al., 2007
oxt Fig. 3 from Eaton et al., 2007
shha Fig. 4 from Eaton et al., 2007
sim1a Fig. 5 from Eaton et al., 2007
PHENOTYPE
Phenotype resulting from MO2-otpb
Phenotype of all Fish created by or utilizing MO2-otpb
Genome Resources:
CITATIONS (2)