Community Action Needed: Please respond to the NIH RFI
Morpholino

MO3-jag2b

ID
ZDB-MRPHLNO-070206-8
Name
MO3-jag2b
Previous Names
  • MO3-jag2
Target
Sequence
5' - GACGAATACTCACTGTTCTGAGTGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice blocking morpholino
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-jag2b
Expressed Gene Anatomy Figures
ins Fig. S2 with image from Zecchin et al., 2007
prss1 Fig. S2 with image from Zecchin et al., 2007
Phenotype
Phenotype resulting from MO3-jag2b
No data available
Phenotype of all Fish created by or utilizing MO3-jag2b
No data available
Citations