Morpholino

MO3-jag1b

ID
ZDB-MRPHLNO-070206-6
Name
MO3-jag1b
Previous Names
None
Target
Sequence
5' - AATCCTGCTACTCACTTTCACTGGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice blocking morpholino
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-jag1b
Expressed Gene Anatomy Figures
gcga Fig. S2 with image from Zecchin et al., 2007
nkx2.4b Fig. 7 from Porazzi et al., 2012
slc5a5 Fig. 7 from Porazzi et al., 2012
tg Fig. 7 from Porazzi et al., 2012
Phenotype
Phenotype resulting from MO3-jag1b
Phenotype Fish Figures
ceratohyal cartilage decreased size, abnormal WT + MO3-jag1b Fig. S5 from Porazzi et al., 2012
embryonic viscerocranium morphogenesis decreased process quality, abnormal WT + MO3-jag1b Fig. S5 from Porazzi et al., 2012
endocrine system has fewer parts of type thyroid follicle, abnormal WT + MO3-jag1b Fig. 7 from Porazzi et al., 2012
hyosymplectic cartilage malformed, abnormal WT + MO3-jag1b Fig. S5 from Porazzi et al., 2012
Meckel's cartilage decreased size, abnormal WT + MO3-jag1b Fig. S5 from Porazzi et al., 2012
palatoquadrate cartilage decreased size, abnormal WT + MO3-jag1b Fig. S5 from Porazzi et al., 2012
thyroid gland development decreased process quality, abnormal WT + MO3-jag1b Fig. 7 from Porazzi et al., 2012
thyroid primordium malformed, abnormal WT + MO3-jag1b Fig. 7 from Porazzi et al., 2012
Phenotype of all Fish created by or utilizing MO3-jag1b
Phenotype Fish Conditions Figures
thyroid primordium malformed, abnormal WT + MO3-jag1b standard conditions Fig. 7 from Porazzi et al., 2012
thyroid gland development decreased process quality, abnormal WT + MO3-jag1b standard conditions Fig. 7 from Porazzi et al., 2012
Meckel's cartilage decreased size, abnormal WT + MO3-jag1b standard conditions Fig. S5 from Porazzi et al., 2012
ceratohyal cartilage decreased size, abnormal WT + MO3-jag1b standard conditions Fig. S5 from Porazzi et al., 2012
endocrine system has fewer parts of type thyroid follicle, abnormal WT + MO3-jag1b standard conditions Fig. 7 from Porazzi et al., 2012
embryonic viscerocranium morphogenesis decreased process quality, abnormal WT + MO3-jag1b standard conditions Fig. S5 from Porazzi et al., 2012
hyosymplectic cartilage malformed, abnormal WT + MO3-jag1b standard conditions Fig. S5 from Porazzi et al., 2012
palatoquadrate cartilage decreased size, abnormal WT + MO3-jag1b standard conditions Fig. S5 from Porazzi et al., 2012
pharyngeal endoderm nkx2.4b expression decreased amount, abnormal AB + MO3-jag1b + MO4-jag1a standard conditions Fig. 2 from de Filippis et al., 2016
caudal fin truncated, abnormal AB + MO3-jag1b + MO4-jag1a standard conditions Fig. 2 from de Filippis et al., 2016
notochord morphology, abnormal AB + MO3-jag1b + MO4-jag1a standard conditions Fig. 2 from de Filippis et al., 2016
thyroid stimulating hormone secreting cell tshba expression increased amount, abnormal AB + MO3-jag1b + MO4-jag1a standard conditions Fig. 3 from de Filippis et al., 2016
whole organism anterior-posterior axis decreased length, abnormal AB + MO3-jag1b + MO4-jag1a standard conditions Fig. 2 from de Filippis et al., 2016
thyroid follicle slc5a5 expression decreased amount, abnormal AB + MO3-jag1b + MO4-jag1a standard conditions Fig. 2 from de Filippis et al., 2016
thyroid primordium aplastic/hypoplastic, abnormal AB + MO3-jag1b + MO4-jag1a standard conditions Fig. 2 from de Filippis et al., 2016
thyroid primordium tg expression decreased amount, abnormal AB + MO3-jag1b + MO4-jag1a standard conditions Fig. 2 from de Filippis et al., 2016
whole organism tshba expression increased amount, abnormal AB + MO3-jag1b + MO4-jag1a standard conditions Fig. 3 from de Filippis et al., 2016
caudal fin kinked, abnormal AB + MO3-jag1b + MO4-jag1a standard conditions Fig. 2 from de Filippis et al., 2016
thyroid primordium slc5a5 expression decreased amount, abnormal AB + MO3-jag1b + MO4-jag1a standard conditions Fig. 2 from de Filippis et al., 2016
whole organism tg expression decreased amount, abnormal AB + MO3-jag1b + MO4-jag1a standard conditions Fig. 3 from de Filippis et al., 2016
thyroid follicle tg expression decreased amount, abnormal AB + MO3-jag1b + MO4-jag1a standard conditions Fig. 2,  Fig. 3 from de Filippis et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.