Morpholino

MO2-fezf2

ID

ZDB-MRPHLNO-070129-7

Name

MO2-fezf2

Previous Names

Target

Sequence

5' - TATTTTAACCTACCTGTGTGTGAAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Exon2-Intron2 splice-blocker

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-fezf2

Expressed Gene	Anatomy	Figures
emx2	hypothalamus postero-ventral region	Fig. 2 from Wolf et al., 2013
eomesa	diencephalon telencephalon	Fig. 5 from Chen et al., 2011
fgf8a	hypothalamus posterior region	Fig. 2 from Wolf et al., 2013
foxb1a	hypothalamus posterior region	Fig. 2 , Fig. 5 from Wolf et al., 2013
lhx2b	forebrain hindbrain	Fig. 5 from Chen et al., 2011
neurog1	(not) diencephalon telencephalon	Fig. 6 from Jeong et al., 2006
otpa	hypothalamus posterior region	Fig. 5 from Wolf et al., 2013
pcna	dorsal telencephalon ventricular zone	Fig. 3 from Berberoglu et al., 2014
sim1a	hypothalamus posterior region	Fig. 5 from Wolf et al., 2013
uts1	hypothalamus posterior region	Fig. 7 from Wolf et al., 2013
vip	hypothalamus posterior region	Fig. 7 from Wolf et al., 2013
wnt8b	hypothalamus posterior region	Fig. 2 from Wolf et al., 2013

Phenotype

Phenotype resulting from MO2-fezf2

Phenotype	Fish	Figures
commissural neuron axon guidance disrupted, abnormal	WT + MO2-fezf2	Fig. 5 from Chen et al., 2011
dorsal telencephalon neuronal stem cell proliferative, abnormal	s2503Tg + MO2-fezf2	Fig. 3 from Berberoglu et al., 2014
ventral thalamus decreased size, abnormal	WT + MO2-fezf2	Fig. 2 from Wolf et al., 2013

Phenotype of all Fish created by or utilizing MO2-fezf2

Phenotype	Fish	Conditions	Figures
caudal tuberculum physical object quality, abnormal	fezf2^m808/m808 + MO2-fezf2 + MO3-fezf2	standard conditions	Fig. 3 from Blechman et al., 2007
preoptic area physical object quality, abnormal	fezf2^m808/m808 + MO2-fezf2 + MO3-fezf2	standard conditions	Fig. 3 from Blechman et al., 2007
hypothalamus physical object quality, abnormal	fezf2^m808/m808 + MO2-fezf2 + MO3-fezf2	standard conditions	Fig. 3 from Blechman et al., 2007
commissural neuron axon guidance disrupted, abnormal	WT + MO2-fezf2	standard conditions	Fig. 5 from Chen et al., 2011
ventral thalamus decreased size, abnormal	WT + MO2-fezf2	standard conditions	Fig. 2 from Wolf et al., 2013
dorsal telencephalon neuronal stem cell proliferative, abnormal	s2503Tg + MO2-fezf2	standard conditions	Fig. 3 from Berberoglu et al., 2014

Citations