Morpholino
MO7-pkd2
- ID
- ZDB-MRPHLNO-070129-4
- Name
- MO7-pkd2
- Previous Names
-
- pkd2 MOex12 (1)
- Target
- Sequence
-
5' - CAGGTGATGTTTACACTTGGAACTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
splice-blocker
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO7-pkd2
No data available
Phenotype
Phenotype resulting from MO7-pkd2
1 - 5 of 7 Show all
Phenotype of all Fish created by or utilizing MO7-pkd2
1 - 5 of 11 Show all
Citations
- Le Corre, S., Eyre, D., Drummond, I.A. (2014) Modulation of the Secretory Pathway Rescues Zebrafish Polycystic Kidney Disease Pathology. Journal of the American Society of Nephrology : JASN. 25(8):1749-59
- Mangos, S., Lam, P.Y., Zhao, A., Liu, Y., Mudumana, S., Vasilyev, A., Liu, A., and Drummond, I.A. (2010) The ADPKD genes pkd1a/b and pkd2 regulate extracellular matrix formation. Disease models & mechanisms. 3(5-6):354-365
- Vasilyev, A., Liu, Y., Mudumana, S., Mangos, S., Lam, P.Y., Majumdar, A., Zhao, J., Poon, K.L., Kondrychyn, I., Korzh, V., and Drummond, I.A. (2009) Collective Cell Migration Drives Morphogenesis of the Kidney Nephron. PLoS Biology. 7(1):e9
- Obara, T., Mangos, S., Liu, Y., Zhao, J., Wiessner, S., Kramer-Zucker, A.G., Olale, F., Schier, A.F., and Drummond, I.A. (2006) Polycystin-2 Immunolocalization and Function in Zebrafish. Journal of the American Society of Nephrology : JASN. 17(10):2706-2718
1 - 4 of 4
Show