Morpholino

MO7-pkd2

ID

ZDB-MRPHLNO-070129-4

Name

MO7-pkd2

Previous Names

Target

Sequence

5' - CAGGTGATGTTTACACTTGGAACTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

splice-blocker

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO7-pkd2

No data available

Phenotype

Phenotype resulting from MO7-pkd2

Phenotype	Fish	Figures
brain hydrocephalic, abnormal	WT + MO7-pkd2	Fig. 2 from Mangos et al., 2010
cell migration arrested, abnormal	sqet33D10Et + MO7-pkd2 (AB)	Fig. 7 from Vasilyev et al., 2009
post-vent region curved dorsal, abnormal	WT + MO7-pkd2	Fig. 2, Fig. 3, Fig. 5 from Mangos et al., 2010
pronephric duct increased size, abnormal	WT + MO7-pkd2	Fig. 5 from Obara et al., 2006
pronephros cystic, abnormal	li1Tg + MO7-pkd2	Fig. 2, Fig. 5 from Le Corre et al., 2014 Fig. 5 from Obara et al., 2006
proximal convoluted tubule development arrested, abnormal	sqet33D10Et + MO7-pkd2 (AB)	Fig. 7 from Vasilyev et al., 2009
whole organism anterior-posterior axis curved dorsal, abnormal	AB/TU + MO7-pkd2	Fig. 1, Fig. 2, Fig. 4 from Le Corre et al., 2014 Fig. 5 from Obara et al., 2006

Phenotype of all Fish created by or utilizing MO7-pkd2

Phenotype	Fish	Conditions	Figures
whole organism anterior-posterior axis curved dorsal, abnormal	AB/TU + MO7-pkd2	control	Fig. 1, Fig. 2, Fig. 4 from Le Corre et al., 2014
whole organism anterior-posterior axis curved dorsal, abnormal	WT + MO7-pkd2	standard conditions	Fig. 5 from Obara et al., 2006
pronephric duct increased size, abnormal	WT + MO7-pkd2	standard conditions	Fig. 5 from Obara et al., 2006
brain hydrocephalic, abnormal	WT + MO7-pkd2	standard conditions	Fig. 2 from Mangos et al., 2010
post-vent region curved dorsal, abnormal	WT + MO7-pkd2	standard conditions	Fig. 2, Fig. 3, Fig. 5 from Mangos et al., 2010
pronephros cystic, abnormal	WT + MO7-pkd2	standard conditions	Fig. 5 from Obara et al., 2006
pronephros cystic, abnormal	li1Tg + MO7-pkd2	chemical treatment: brefeldin A	Fig. 5 from Le Corre et al., 2014
pronephros cystic, abnormal	li1Tg + MO7-pkd2	control	Fig. 2, Fig. 5 from Le Corre et al., 2014
proximal convoluted tubule development arrested, abnormal	sqet33D10Et + MO7-pkd2 (AB)	standard conditions	Fig. 7 from Vasilyev et al., 2009
cell migration arrested, abnormal	sqet33D10Et + MO7-pkd2 (AB)	standard conditions	Fig. 7 from Vasilyev et al., 2009
post-vent region curved dorsal, abnormal	WT + MO1-pkd1b + MO2-pkd1a + MO7-pkd2	standard conditions	Fig. 3 from Mangos et al., 2010

Citations