Morpholino

MO5-pkd2

ID
ZDB-MRPHLNO-070129-2
Name
MO5-pkd2
Previous Names
  • pkd2 MOex3 (1)
Target
Sequence
5' - AATTACTTTCCAGAAGTCCTCCATG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
splice blocker
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-pkd2
No data available
Phenotype
Phenotype resulting from MO5-pkd2
Phenotype Fish Figures
brain hydrocephalic, abnormal WT + MO5-pkd2 Fig. 4 from Köttgen et al., 2008
determination of left/right symmetry disrupted, abnormal WT + MO5-pkd2 Fig. 6 from Obara et al., 2006
head hydrocephalic, abnormal WT + MO5-pkd2 Fig. 5 from Obara et al., 2006
post-vent region curved dorsal, abnormal WT + MO5-pkd2 Fig. 4 from Köttgen et al., 2008
pronephric duct increased size, abnormal WT + MO5-pkd2 Fig. 5,  Fig. 7 from Obara et al., 2006
pronephric duct opening decreased size, abnormal WT + MO5-pkd2 Fig. 9 from Obara et al., 2006
pronephric glomerulus morphology, abnormal WT + MO5-pkd2 Fig. 4 from Köttgen et al., 2008
pronephric tubule dilated, abnormal WT + MO5-pkd2 Fig. 4 from Köttgen et al., 2008
pronephros cystic, abnormal WT + MO5-pkd2 Fig. 4 from Köttgen et al., 2008
Fig. 5,  Fig. 7 from Obara et al., 2006
whole organism anterior-posterior axis curved dorsal, abnormal WT + MO5-pkd2 Fig. 5,  Fig. 7 from Obara et al., 2006
Phenotype of all Fish created by or utilizing MO5-pkd2
Phenotype Fish Conditions Figures
pronephros cystic, abnormal WT + MO5-pkd2 standard conditions Fig. 4 from Köttgen et al., 2008
Fig. 5,  Fig. 7 from Obara et al., 2006
pronephric tubule dilated, abnormal WT + MO5-pkd2 standard conditions Fig. 4 from Köttgen et al., 2008
brain hydrocephalic, abnormal WT + MO5-pkd2 standard conditions Fig. 4 from Köttgen et al., 2008
post-vent region curved dorsal, abnormal WT + MO5-pkd2 standard conditions Fig. 4 from Köttgen et al., 2008
whole organism anterior-posterior axis curved dorsal, abnormal WT + MO5-pkd2 standard conditions Fig. 5,  Fig. 7 from Obara et al., 2006
pronephric glomerulus morphology, abnormal WT + MO5-pkd2 standard conditions Fig. 4 from Köttgen et al., 2008
determination of left/right symmetry disrupted, abnormal WT + MO5-pkd2 standard conditions Fig. 6 from Obara et al., 2006
pronephric duct increased size, abnormal WT + MO5-pkd2 standard conditions Fig. 5,  Fig. 7 from Obara et al., 2006
head hydrocephalic, abnormal WT + MO5-pkd2 standard conditions Fig. 5 from Obara et al., 2006
pronephric duct opening decreased size, abnormal WT + MO5-pkd2 standard conditions Fig. 9 from Obara et al., 2006
pronephros cystic, abnormal WT + MO1-prkcsh + MO5-pkd2 standard conditions Fig. 4 from Gao et al., 2010
pronephros cystic, abnormal WT + MO1-trpv4 + MO5-pkd2 standard conditions Fig. 4 from Köttgen et al., 2008
post-vent region curved dorsal, abnormal WT + MO1-trpv4 + MO5-pkd2 standard conditions Fig. 4 from Köttgen et al., 2008
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.