Morpholino

MO1-smarca4a

ID

ZDB-MRPHLNO-061215-3

Name

MO1-smarca4a

Previous Names

Target

Sequence

5' - CATGGGTGGGTCAGGAGTGGACATC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-smarca4a

Expressed Gene	Anatomy	Figures
ctnnb1	whole organism	Fig. 10 from Eroglu et al., 2006
egr2b	neural plate presumptive rhombomere 3 presumptive rhombomere 5	Fig. 3 from Eroglu et al., 2006
en2a	(not) midbrain hindbrain boundary neural keel (not) midbrain hindbrain boundary neural plate whole organism	Fig. 3 , Fig. 10 from Eroglu et al., 2006
foxd3	neural crest	Fig. 6 from Eroglu et al., 2006
fzd2	whole organism	Fig. 10 from Eroglu et al., 2006
gsc	unspecified	Fig. 3 from Eroglu et al., 2006
hlx1	brain neuroectoderm	Fig. 3 from Eroglu et al., 2006
hnf1a	whole organism	Fig. 10 from Eroglu et al., 2006
lef1	whole organism	Fig. 10 from Eroglu et al., 2006
myod1	somite	Fig. 3 from Eroglu et al., 2006
six3a	neural keel	Fig. 3 from Eroglu et al., 2006
smarca4a	whole organism	Fig. 10 from Eroglu et al., 2006
snai1b	neural crest whole organism	Fig. 6 , Fig. 10 from Eroglu et al., 2006
tbxta	notochord	Fig. 3 from Eroglu et al., 2006
tfap2a	neural crest	Fig. 6 from Eroglu et al., 2006
wnt1	whole organism	Fig. 10 from Eroglu et al., 2006
wnt4	whole organism	Fig. 10 from Eroglu et al., 2006
wnt8b	whole organism	Fig. 10 from Eroglu et al., 2006
wnt10b	whole organism	Fig. 10 from Eroglu et al., 2006

Phenotype

Phenotype resulting from MO1-smarca4a

Phenotype	Fish	Figures
cardiac muscle cell decreased amount, abnormal	hsc4Tg + MO1-smarca4a	Fig. 3 from Takeuchi et al., 2011
cell migration involved in heart development decreased rate, abnormal	twu34Tg/+ + MO1-smarca4a	Fig. 3 from Takeuchi et al., 2011
chromatin organization process quality, abnormal	TU + MO1-smarca4a	Fig. S7 from Liu et al., 2018
ear development disrupted, abnormal	WT + MO1-smarca4a	text only from Gregg et al., 2003
fin morphology, abnormal	WT + MO1-smarca4a	text only from Gregg et al., 2003
fin development disrupted, abnormal	WT + MO1-smarca4a	text only from Gregg et al., 2003
heart morphology, abnormal	WT + MO1-smarca4a	text only from Gregg et al., 2003
heart morphogenesis disrupted, abnormal	WT + MO1-smarca4a	text only from Gregg et al., 2003
inner ear morphology, abnormal	WT + MO1-smarca4a	text only from Gregg et al., 2003
melanocyte decreased amount, abnormal	WT + MO1-smarca4a	text only from Gregg et al., 2003
retina structure, abnormal	WT + MO1-smarca4a	text only from Gregg et al., 2003
retina layer formation arrested, abnormal	WT + MO1-smarca4a	text only from Gregg et al., 2003

Phenotype of all Fish created by or utilizing MO1-smarca4a

Phenotype	Fish	Conditions	Figures
chromatin organization process quality, abnormal	TU + MO1-smarca4a	standard conditions	Fig. S7 from Liu et al., 2018
inner ear morphology, abnormal	WT + MO1-smarca4a	standard conditions	text only from Gregg et al., 2003
ear development disrupted, abnormal	WT + MO1-smarca4a	standard conditions	text only from Gregg et al., 2003
fin morphology, abnormal	WT + MO1-smarca4a	standard conditions	text only from Gregg et al., 2003
melanocyte decreased amount, abnormal	WT + MO1-smarca4a	standard conditions	text only from Gregg et al., 2003
retina structure, abnormal	WT + MO1-smarca4a	standard conditions	text only from Gregg et al., 2003
heart morphogenesis disrupted, abnormal	WT + MO1-smarca4a	standard conditions	text only from Gregg et al., 2003
retina layer formation arrested, abnormal	WT + MO1-smarca4a	standard conditions	text only from Gregg et al., 2003
fin development disrupted, abnormal	WT + MO1-smarca4a	standard conditions	text only from Gregg et al., 2003
heart morphology, abnormal	WT + MO1-smarca4a	standard conditions	text only from Gregg et al., 2003
cell migration involved in heart development decreased rate, abnormal	twu34Tg/+ + MO1-smarca4a	standard conditions	Fig. 3 from Takeuchi et al., 2011
cardiac muscle cell decreased amount, abnormal	hsc4Tg + MO1-smarca4a	standard conditions	Fig. 3 from Takeuchi et al., 2011

Citations