header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-061215-3
Morpholino Name: MO1-smarca4a
Target: smarca4a (1)
Previous Names: Brg1MO2 (1), MO1-smarca4

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CATGGGTGGGTCAGGAGTGGACATC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-smarca4a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-smarca4a
Expressed Gene Anatomy Figures
ctnnb1 Fig. 10 with image from Eroglu et al., 2006
egr2b Fig. 3 with image from Eroglu et al., 2006
en2a Fig. 3 with imageFig. 10 with image from Eroglu et al., 2006
foxd3 Fig. 6 with image from Eroglu et al., 2006
fzd2 Fig. 10 with image from Eroglu et al., 2006
gsc Fig. 3 with image from Eroglu et al., 2006
hlx1 Fig. 3 with image from Eroglu et al., 2006
hnf1a Fig. 10 with image from Eroglu et al., 2006
lef1 Fig. 10 with image from Eroglu et al., 2006
myod1 Fig. 3 with image from Eroglu et al., 2006
six3a Fig. 3 with image from Eroglu et al., 2006
smarca4a Fig. 10 with image from Eroglu et al., 2006
snai1b Fig. 6 with imageFig. 10 with image from Eroglu et al., 2006
tbxta Fig. 3 with image from Eroglu et al., 2006
tfap2a Fig. 6 with image from Eroglu et al., 2006
wnt1 Fig. 10 with image from Eroglu et al., 2006
wnt4 Fig. 10 with image from Eroglu et al., 2006
wnt8b Fig. 10 with image from Eroglu et al., 2006
wnt10b Fig. 10 with image from Eroglu et al., 2006
PHENOTYPE
Phenotype resulting from MO1-smarca4a
Phenotype of all Fish created by or utilizing MO1-smarca4a
Genome Resources:
CITATIONS (5)