ZFIN ID: ZDB-MRPHLNO-061013-1
Morpholino Name: MO1-metap2b
Target: metap2b (1)
Previous Name: MO1-metap2

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CATGTCTTTACCCATCTTGCACAGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-metap2b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-metap2b
Expressed Gene Anatomy Figures
efnb2a Fig. 3 from Ma et al., 2011
flt4 Fig. 3 from Ma et al., 2011
mpx Fig. 2 from Ma et al., 2011
myb Fig. 2 from Ma et al., 2011
myod1 Fig. S3 from Zhang et al., 2006
PHENOTYPE
Phenotype resulting from MO1-metap2b
Phenotype of all Fish created by or utilizing MO1-metap2b
Phenotype Fish Conditions Figures
convergent extension involved in axis elongation disrupted, abnormal WT + MO1-metap2b standard conditions Fig. 3 from Zhang et al., 2006
post-anal tail morphogenesis disrupted, abnormal WT + MO1-metap2b standard conditions Fig. 3 from Zhang et al., 2006
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal WT + MO1-metap2b standard conditions Fig. 2 from Ma et al., 2011
post-vent region decreased length, abnormal WT + MO1-metap2b standard conditions Fig. 3 from Zhang et al., 2006
non-canonical Wnt signaling pathway disrupted, abnormal WT + MO1-metap2b standard conditions text only from Ma et al., 2011
myeloid cell differentiation process quality, abnormal WT + MO1-metap2b standard conditions Fig. 2 from Ma et al., 2011
protein initiator methionine removal decreased occurrence, abnormal WT + MO1-metap2b standard conditions Fig. 5 from Ma et al., 2011
sprouting angiogenesis disrupted, abnormal y1Tg + MO1-metap2b standard conditions Fig. 3 from Ma et al., 2011
intersegmental vessel morphology, abnormal y1Tg + MO1-metap2b standard conditions Fig. 3 from Ma et al., 2011
protein phosphorylation increased occurrence, abnormal y1Tg + MO1-metap2b standard conditions Fig. 5 from Ma et al., 2011
post-vent region decreased length, abnormal WT + MO1-metap2b + MO1-wnt5b standard conditions Fig. 3 from Zhang et al., 2006
convergent extension involved in axis elongation disrupted, abnormal WT + MO1-metap2b + MO1-wnt5b standard conditions Fig. 3 from Zhang et al., 2006
somite increased width, abnormal WT + MO1-metap2b + MO1-wnt5b standard conditions Fig. 3 from Zhang et al., 2006
post-anal tail morphogenesis disrupted, abnormal WT + MO1-metap2b + MO1-wnt5b standard conditions Fig. 3 from Zhang et al., 2006
Genome Resources:
CITATIONS (2)