Morpholino
MO1-en2a
- ID
- ZDB-MRPHLNO-060930-2
- Name
- MO1-en2a
- Previous Names
-
- MO1-eng2a
- Target
- Sequence
-
5' - CGCTCTGCTCATTCTCATCCATGCT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-en2a
Expressed Gene | Anatomy | Figures |
---|---|---|
en2b | (all 4) |
Fig. 1
from Scholpp et al., 2001 |
1 - 1 of 1
Phenotype
Phenotype resulting from MO1-en2a
Phenotype | Fish | Figures |
---|---|---|
optic tectum decreased size, abnormal | WT + MO1-en2a |
Fig. 1
from Scholpp et al., 2001 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO1-en2a
1 - 5 of 13 Show all
Citations
- Albuixech-Crespo, B., López-Blanch, L., Burguera, D., Maeso, I., Sánchez-Arrones, L., Moreno-Bravo, J.A., Somorjai, I., Pascual-Anaya, J., Puelles, E., Bovolenta, P., Garcia-Fernàndez, J., Puelles, L., Irimia, M., Ferran, J.L. (2017) Molecular regionalization of the developing amphioxus neural tube challenges major partitions of the vertebrate brain. PLoS Biology. 15:e2001573
- Dworkin, S., Darido, C., Georgy, S.R., Wilanowski, T., Srivastava, S., Ellett, F., Pase, L., Han, Y., Meng, A., Heath, J.K., Lieschke, G.J., and Jane, S.M. (2012) Midbrain-hindbrain boundary patterning and morphogenesis are regulated by diverse grainy head-like 2-dependent pathways. Development (Cambridge, England). 139(3):525-536
- Erickson, T., Scholpp, S., Brand, M., Moens, C.B., and Waskiewicz, A. Jan (2007) Pbx proteins cooperate with Engrailed to pattern the midbrain-hindbrain and diencephalic-mesencephalic boundaries. Developmental Biology. 301(2):504-517
- Picker, A., Scholpp, S., Bohli, H., Takeda, H., and Brand, M. (2002) A novel positive transcriptional feedback loop in midbrain-hindbrain boundary development is revealed through analysis of the zebrafish pax2.1 promoter in transgenic lines. Development (Cambridge, England). 129(13):3227-3239
- Scholpp, S. and Brand, M. (2001) Morpholino-induced knockdown of zebrafish engrailed genes eng2 and eng3 reveals redundant and unique functions in midbrain–hindbrain boundary development. Genesis (New York, N.Y. : 2000). 30(3):129-133
1 - 5 of 5
Show