Morpholino
MO2-tfap2a
- ID
- ZDB-MRPHLNO-060927-2
- Name
- MO2-tfap2a
- Previous Names
- Target
- Sequence
-
5' - GAAATTGCTTACCTTTTTTGATTAC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking morpholino.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-tfap2a
Expressed Gene | Anatomy | Figures |
---|---|---|
hand2 |
Fig. 5 ![]() |
1 - 1 of 1
Phenotype
Phenotype resulting from MO2-tfap2a
1 - 5 of 8 Show all
Phenotype of all Fish created by or utilizing MO2-tfap2a
1 - 5 of 14 Show all
Citations
- Van Otterloo, E., Li, W., Bonde, G., Day, K.M., Hsu, M.Y., and Cornell, R.A. (2010) Differentiation of zebrafish melanophores depends on transcription factors AP2 alpha and AP2 epsilon. PLoS Genetics. 6(9):pii: e1001122
- Gestri, G., Osborne, R.J., Wyatt, A.W., Gerrelli, D., Gribble, S., Stewart, H., Fryer, A., Bunyan, D.J., Prescott, K., Collin, J.R., Fitzgerald, T., Robinson, D., Carter, N.P., Wilson, S.W., and Ragge, N.K. (2009) Reduced TFAP2A function causes variable optic fissure closure and retinal defects and sensitizes eye development to mutations in other morphogenetic regulators. Human genetics. 126(6):791-803
- Wendl, T., Adzic, D., Schoenebeck, J.J., Scholpp, S., Brand, M., Yelon, D., and Rohr, K.B. (2007) Early developmental specification of the thyroid gland depends on han-expressing surrounding tissue and on FGF signals. Development (Cambridge, England). 134(15):2871-2879
- O'Brien, E.K., d'Alencon, C., Bonde, G., Li, W., Schoenebeck, J., Allende, M.L., Gelb, B.D., Yelon, D., Eisen, J.S., and Cornell, R.A. (2004) Transcription factor Ap-2alpha is necessary for development of embryonic melanophores, autonomic neurons and pharyngeal skeleton in zebrafish. Developmental Biology. 265(1):246-261
- Knight, R.D., Nair, S., Nelson, S.S., Afshar, A., Javidan, Y., Geisler, R., Rauch, G.J., and Schilling, T.F. (2003) lockjaw encodes a zebrafish tfap2a required for early neural crest development. Development (Cambridge, England). 130(23):5755-5768
1 - 5 of 5
Show