Morpholino

MO1-lrp2a

ID
ZDB-MRPHLNO-060919-4
Name
MO1-lrp2a
Previous Names
  • megMO1 (1)
  • MO1-lrp2 (1)
Target
Sequence
5' - AATCAGTGCTTGTGGTTTACCTGGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
splice-blocker
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-lrp2a
No data available
Phenotype
Phenotype resulting from MO1-lrp2a
Phenotype of all Fish created by or utilizing MO1-lrp2a
Phenotype Fish Conditions Figures
cardiac ventricle decreased size, abnormal sd12Tg/sd12Tg + MO1-lrp2a standard conditions Figure 3 from Theis et al., 2020
atrium cardiac muscle cell decreased amount, abnormal sd12Tg/sd12Tg + MO1-lrp2a standard conditions Figure 3 from Theis et al., 2020
heart decreased size, abnormal sd12Tg/sd12Tg + MO1-lrp2a standard conditions Figure 3 from Theis et al., 2020
cardiac ventricle cardiac muscle cell decreased amount, abnormal sd12Tg/sd12Tg + MO1-lrp2a standard conditions Figure 3 from Theis et al., 2020
heart morphology, abnormal sd12Tg/sd12Tg + MO1-lrp2a standard conditions Figure 3 from Theis et al., 2020
cardiac ventricle decreased size, abnormal AB + MO1-lrp2a standard conditions Figure 3 - figure supplement 1 with image from Theis et al., 2020
cardiac ventricle decreased contractility, abnormal AB + MO1-lrp2a standard conditions Figure 3 - figure supplement 1 with image from Theis et al., 2020
pericardium edematous, abnormal AB + MO1-lrp2a standard conditions Figure 3 - figure supplement 1 with image from Theis et al., 2020
heart contraction decreased rate, abnormal AB + MO1-lrp2a standard conditions Figure 3 - figure supplement 1 with image from Theis et al., 2020
renal absorption disrupted, abnormal WT + MO1-lrp2a chemical treatment: fluorescein (lactone form) Fig. 7 from Anzenberger et al., 2006
renal absorption arrested, abnormal WT + MO1-lrp2a chemical treatment: protein Fig. 8 from Anzenberger et al., 2006
pronephric duct early endosome absent, abnormal WT + MO1-lrp2a chemical treatment: fluorescein (lactone form) Fig. 9 from Anzenberger et al., 2006
receptor-mediated endocytosis disrupted, abnormal WT + MO1-lrp2a chemical treatment: fluorescein (lactone form) Fig. 9 from Anzenberger et al., 2006
cardiac ventricle decreased size, abnormal twu277Tg + MO1-lrp2a standard conditions Figure 3 from Theis et al., 2020
atrium cardiac muscle cell decreased amount, abnormal twu277Tg + MO1-lrp2a standard conditions Figure 3 from Theis et al., 2020
heart decreased size, abnormal twu277Tg + MO1-lrp2a standard conditions Figure 3 from Theis et al., 2020
heart morphology, abnormal twu277Tg + MO1-lrp2a standard conditions Figure 3 from Theis et al., 2020
cardiac ventricle cardiac muscle cell decreased amount, abnormal twu277Tg + MO1-lrp2a standard conditions Figure 3 from Theis et al., 2020
renal albumin absorption decreased occurrence, abnormal rw0144Tg; zf2102Tg + MO1-lrp2a (AB) standard conditions Fig. 5 from Wan et al., 2016
pericardium edematous, abnormal WT + MO1-lrp2a + MO1-lrp2b chemical treatment: cisplatin Fig. 2 from McMahon et al., 2014
pronephros edematous, abnormal WT + MO1-lrp2a + MO1-lrp2b chemical treatment: gentamycin C1 Fig. 2 from McMahon et al., 2014
pronephric duct proximal region decreased functionality, abnormal umc407Tg + MO1-lrp2a + MO4-tp53 standard conditions Fig. 2 with imageFig. 3 with image from Naylor et al., 2022
urine protein increased amount, abnormal umc407Tg + MO1-lrp2a + MO4-tp53 standard conditions Fig. 2 with imageFig. 3 with image from Naylor et al., 2022
renal albumin absorption decreased occurrence, exacerbated rw0144Tg; zf2102Tg; zf3005Tg + MO1-lrp2a (AB) standard conditions Fig. 5 from Wan et al., 2016
urine protein increased amount, exacerbated rw0144Tg; zf2102Tg; zf3005Tg + MO1-lrp2a (AB) standard conditions Fig. 5 from Wan et al., 2016
pronephros EGFP expression increased amount, abnormal rw0144Tg; zf2102Tg; zf3005Tg + MO1-lrp2a (AB) standard conditions Fig. 5 from Wan et al., 2016
Citations