Morpholino

MO1-lrp2a

ID
ZDB-MRPHLNO-060919-4
Name
MO1-lrp2a
Previous Names
  • megMO1 (1)
  • MO1-lrp2 (1)
Target
Sequence
5' - AATCAGTGCTTGTGGTTTACCTGGG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
splice-blocker
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-lrp2a
Expressed Gene Anatomy Figures
lrp2a Fig. 6 from Anzenberger et al., 2006
rab4a text only from Anzenberger et al., 2006
Phenotype
Phenotype resulting from MO1-lrp2a
Phenotype Fish Figures
atrium cardiac muscle cell decreased amount, abnormal sd12Tg/sd12Tg + MO1-lrp2a Figure 3 from Theis et al., 2020
cardiac ventricle decreased contractility, abnormal AB + MO1-lrp2a Figure 3 - figure supplement 1 with image from Theis et al., 2020
cardiac ventricle decreased size, abnormal sd12Tg/sd12Tg + MO1-lrp2a Figure 3,  Figure 3 - figure supplement 1 with image from Theis et al., 2020
cardiac ventricle cardiac muscle cell decreased amount, abnormal twu277Tg + MO1-lrp2a Figure 3 from Theis et al., 2020
heart decreased size, abnormal sd12Tg/sd12Tg + MO1-lrp2a Figure 3 from Theis et al., 2020
heart morphology, abnormal twu277Tg + MO1-lrp2a Figure 3 from Theis et al., 2020
heart contraction decreased rate, abnormal AB + MO1-lrp2a Figure 3 - figure supplement 1 with image from Theis et al., 2020
pericardium edematous, abnormal AB + MO1-lrp2a Figure 3 - figure supplement 1 with image from Theis et al., 2020
renal albumin absorption decreased occurrence, abnormal rw0144Tg; zf2102Tg + MO1-lrp2a (AB) Fig. 5 from Wan et al., 2016
Phenotype of all Fish created by or utilizing MO1-lrp2a
Phenotype Fish Conditions Figures
cardiac ventricle decreased size, abnormal sd12Tg/sd12Tg + MO1-lrp2a standard conditions Figure 3 from Theis et al., 2020
atrium cardiac muscle cell decreased amount, abnormal sd12Tg/sd12Tg + MO1-lrp2a standard conditions Figure 3 from Theis et al., 2020
heart decreased size, abnormal sd12Tg/sd12Tg + MO1-lrp2a standard conditions Figure 3 from Theis et al., 2020
cardiac ventricle cardiac muscle cell decreased amount, abnormal sd12Tg/sd12Tg + MO1-lrp2a standard conditions Figure 3 from Theis et al., 2020
heart morphology, abnormal sd12Tg/sd12Tg + MO1-lrp2a standard conditions Figure 3 from Theis et al., 2020
cardiac ventricle decreased contractility, abnormal AB + MO1-lrp2a standard conditions Figure 3 - figure supplement 1 with image from Theis et al., 2020
cardiac ventricle decreased size, abnormal AB + MO1-lrp2a standard conditions Figure 3 - figure supplement 1 with image from Theis et al., 2020
pericardium edematous, abnormal AB + MO1-lrp2a standard conditions Figure 3 - figure supplement 1 with image from Theis et al., 2020
heart contraction decreased rate, abnormal AB + MO1-lrp2a standard conditions Figure 3 - figure supplement 1 with image from Theis et al., 2020
renal absorption disrupted, abnormal WT + MO1-lrp2a chemical treatment: fluorescein (lactone form) Fig. 7 from Anzenberger et al., 2006
renal absorption arrested, abnormal WT + MO1-lrp2a chemical treatment: protein Fig. 8 from Anzenberger et al., 2006
pronephric duct early endosome absent, abnormal WT + MO1-lrp2a chemical treatment: fluorescein (lactone form) Fig. 9 from Anzenberger et al., 2006
receptor-mediated endocytosis disrupted, abnormal WT + MO1-lrp2a chemical treatment: fluorescein (lactone form) Fig. 9 from Anzenberger et al., 2006
cardiac ventricle decreased size, abnormal twu277Tg + MO1-lrp2a standard conditions Figure 3 from Theis et al., 2020
atrium cardiac muscle cell decreased amount, abnormal twu277Tg + MO1-lrp2a standard conditions Figure 3 from Theis et al., 2020
heart decreased size, abnormal twu277Tg + MO1-lrp2a standard conditions Figure 3 from Theis et al., 2020
cardiac ventricle cardiac muscle cell decreased amount, abnormal twu277Tg + MO1-lrp2a standard conditions Figure 3 from Theis et al., 2020
heart morphology, abnormal twu277Tg + MO1-lrp2a standard conditions Figure 3 from Theis et al., 2020
renal albumin absorption decreased occurrence, abnormal rw0144Tg; zf2102Tg + MO1-lrp2a (AB) standard conditions Fig. 5 from Wan et al., 2016
pericardium edematous, abnormal WT + MO1-lrp2a + MO1-lrp2b chemical treatment: cisplatin Fig. 2 from McMahon et al., 2014
pronephros edematous, abnormal WT + MO1-lrp2a + MO1-lrp2b chemical treatment: gentamycin C1 Fig. 2 from McMahon et al., 2014
pronephric duct proximal region decreased functionality, abnormal umc407Tg + MO1-lrp2a + MO4-tp53 standard conditions Fig. 2 with image,  Fig. 3 with image from Naylor et al., 2022
urine protein increased amount, abnormal umc407Tg + MO1-lrp2a + MO4-tp53 standard conditions Fig. 2 with image,  Fig. 3 with image from Naylor et al., 2022
renal albumin absorption decreased occurrence, exacerbated rw0144Tg; zf2102Tg; zf3005Tg + MO1-lrp2a (AB) standard conditions Fig. 5 from Wan et al., 2016
urine protein increased amount, exacerbated rw0144Tg; zf2102Tg; zf3005Tg + MO1-lrp2a (AB) standard conditions Fig. 5 from Wan et al., 2016
pronephros EGFP expression increased amount, abnormal rw0144Tg; zf2102Tg; zf3005Tg + MO1-lrp2a (AB) standard conditions Fig. 5 from Wan et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.