header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-060919-1
Morpholino Name: MO1-dab2
Target: dab2 (1)
Previous Name: dab2MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TTCTGCTTCAGGTGACTGTGACATG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: targeted to translation-start
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-dab2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-dab2
Expressed Gene Anatomy Figures
rab4a text only from Anzenberger et al., 2006
PHENOTYPE
Phenotype resulting from MO1-dab2
Phenotype of all Fish created by or utilizing MO1-dab2
OTHER MO1-dab2 MORPHOLINO PAGESNo links to external sites
CITATIONS (3)