Morpholino

MO1-tafazzin

ID

ZDB-MRPHLNO-060918-3

Name

MO1-tafazzin

Previous Names

Target

Sequence

5' - CATGTCACCTCCAAGGGCATCGCCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-tafazzin

Expressed Gene	Anatomy	Figures
myl7	heart	Fig. 3 from Khuchua et al., 2006

Phenotype

Phenotype resulting from MO1-tafazzin

Phenotype	Fish	Figures
blood circulation arrested, abnormal	WT + MO1-tafazzin	Fig. 3 from Khuchua et al., 2006
eye physical object quality, abnormal	WT + MO1-tafazzin	Fig. 3 from Khuchua et al., 2006
heart linear, abnormal	WT + MO1-tafazzin	Fig. 3 from Khuchua et al., 2006
heart morphology, abnormal	WT + MO1-tafazzin	Fig. 3 from Khuchua et al., 2006
heart contraction decreased rate, abnormal	WT + MO1-tafazzin	Fig. 3 from Khuchua et al., 2006
heart looping arrested, abnormal	WT + MO1-tafazzin	Fig. 3 from Khuchua et al., 2006
pericardium edematous, abnormal	WT + MO1-tafazzin	Fig. 3 from Khuchua et al., 2006
post-vent region decreased length, abnormal	WT + MO1-tafazzin	Fig. 3 from Khuchua et al., 2006
post-vent region increased curvature, abnormal	WT + MO1-tafazzin	Fig. 3 from Khuchua et al., 2006
whole organism viability, abnormal	WT + MO1-tafazzin	Fig. 3 from Khuchua et al., 2006

Phenotype of all Fish created by or utilizing MO1-tafazzin

Phenotype	Fish	Conditions	Figures
heart contraction decreased rate, abnormal	WT + MO1-tafazzin	standard conditions	Fig. 3 from Khuchua et al., 2006
post-vent region decreased length, abnormal	WT + MO1-tafazzin	standard conditions	Fig. 3 from Khuchua et al., 2006
pericardium edematous, abnormal	WT + MO1-tafazzin	standard conditions	Fig. 3 from Khuchua et al., 2006
heart morphology, abnormal	WT + MO1-tafazzin	standard conditions	Fig. 3 from Khuchua et al., 2006
heart looping arrested, abnormal	WT + MO1-tafazzin	standard conditions	Fig. 3 from Khuchua et al., 2006
blood circulation arrested, abnormal	WT + MO1-tafazzin	standard conditions	Fig. 3 from Khuchua et al., 2006
whole organism viability, abnormal	WT + MO1-tafazzin	standard conditions	Fig. 3 from Khuchua et al., 2006
eye physical object quality, abnormal	WT + MO1-tafazzin	standard conditions	Fig. 3 from Khuchua et al., 2006
heart linear, abnormal	WT + MO1-tafazzin	standard conditions	Fig. 3 from Khuchua et al., 2006
post-vent region increased curvature, abnormal	WT + MO1-tafazzin	standard conditions	Fig. 3 from Khuchua et al., 2006

Citations