Morpholino
MO2-crb2a
- ID
- ZDB-MRPHLNO-060822-2
- Name
- MO2-crb2a
- Previous Names
- Target
- Sequence
-
5' - ACGTTGCCAGTACCTGTGTATCCTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-crb2a
No data available
Phenotype
Phenotype resulting from MO2-crb2a
No data available
Phenotype of all Fish created by or utilizing MO2-crb2a
from
Citations
- Clark, B.S., Miesfeld, J.B., Flinn, M.A., Collery, R.F., Link, B.A. (2021) Dynamic Polarization of Rab11a Modulates Crb2a Localization and Impacts Signaling to Regulate Retinal Neurogenesis. Frontiers in cell and developmental biology. 8:608112
- Geusz, R.J., Wang, A., Chiou, J., Lancman, J.J., Wetton, N., Kefalopoulou, S., Wang, J., Qui, Y., Yan, J., Aylward, A., Ren, B., Dong, P.D.S., Gaulton, K.J., Sander, M. (2021) Pancreatic progenitor epigenome maps prioritize type 2 diabetes risk genes with roles in development. eLIFE. 10
- Watanabe, K., Nishimura, Y., Oka, T., Nomoto, T., Kon, T., Shintou, T., Hirano, M., Shimada, Y., Umemoto, N., Kuroyanagi, J., Wang, Z., Zhang, Z., Nishimura, N., Miyazaki, T., Imamura, T., and Tanaka, T. (2010) In vivo imaging of zebrafish retinal cells using fluorescent coumarin derivatives. BMC Neuroscience. 11:116
- Omori, Y., and Malicki, J. (2006) oko meduzy and Related crumbs Genes Are Determinants of Apical Cell Features in the Vertebrate Embryo. Current biology : CB. 16(10):945-957
1 - 4 of 4
Show