Morpholino
MO2-tbxta
- ID
- ZDB-MRPHLNO-060809-2
- Name
- MO2-tbxta
- Previous Names
-
- MO2-ntl
- MO2-ta
- Target
- Sequence
-
5' - GCTGGTCGGGACTTGAGGCAGACAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-tbxta
No data available
Phenotype
Phenotype resulting from MO2-tbxta
1 - 5 of 10 Show all
Phenotype of all Fish created by or utilizing MO2-tbxta
1 - 5 of 35 Show all
Citations
- Osborn, D.P.S., Li, K., Cutty, S.J., Nelson, A.C., Wardle, F.C., Hinits, Y., Hughes, S.M. (2020) Fgf-driven Tbx protein activities directly induce myf5 and myod to initiate zebrafish myogenesis. Development (Cambridge, England). 147(8):
- Nelson, A.C., Cutty, S.J., Gasiunas, S.N., Deplae, I., Stemple, D.L., Wardle, F.C. (2017) In Vivo Regulation of the Zebrafish Endoderm Progenitor Niche by T-Box Transcription Factors. Cell Reports. 19:2782-2795
- Colombo, A., Palma, K., Armijo, L., Mione, M., Signore, I.A., Morales, C., Guerrero, N., Meynard, M.M., Pérez, R., Suazo, J., Marcelain, K., Briones, L., Härtel, S., Wilson, S.W., and Concha, M.L. (2013) Daam1a mediates asymmetric habenular morphogenesis by regulating dendritic and axonal outgrowth. Development (Cambridge, England). 140(19):3997-4007
- Jahangiri, L., Nelson, A.C., Wardle, F.C. (2012) A cis-regulatory module upstream of deltaC regulated by Ntla and Tbx16 drives expression in the tailbud, presomitic mesoderm and somites. Developmental Biology. 371:110-120
- Harvey, S.A., Tümpel, S., Dubrulle, J., Schier, A.F., and Smith, J.C. (2010) no tail integrates two modes of mesoderm induction. Development (Cambridge, England). 137(7):1127-1135
- Morley, R.H., Lachani, K., Keefe, D., Gilchrist, M.J., Flicek, P., Smith, J.C., and Wardle, F.C. (2009) A gene regulatory network directed by zebrafish No tail accounts for its roles in mesoderm formation. Proceedings of the National Academy of Sciences of the United States of America. 106(10):3829-3834
- Regan, J.C., Concha, M.L., Roussigne, M., Russell, C., and Wilson, S.W. (2009) An Fgf8-dependent bistable cell migratory event establishes CNS asymmetry. Neuron. 61(1):27-34
- Feldman, B. and Stemple, D.L. (2001) Morpholino phenocopies of sqt, oep, and ntl mutations. Genesis (New York, N.Y. : 2000). 30(3):175-177
1 - 8 of 8
Show