Morpholino

MO1-sema3fa

ID
ZDB-MRPHLNO-060705-7
Name
MO1-sema3fa
Previous Names
None
Target
Sequence
5' - TATCCATAAAACCCACAAGAGATTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-sema3fa
No data available
Phenotype
Phenotype resulting from MO1-sema3fa
No data available
Phenotype of all Fish created by or utilizing MO1-sema3fa
Phenotype Fish Conditions Figures
caudal fin neutrophil increased amount, abnormal i114Tg + MO1-sema3fa amputation: caudal fin Figure 2 with image from Plant et al., 2020
caudal fin neutrophil increased amount, ameliorated i114Tg + MO1-sema3fa amputation: caudal fin Figure 2 with image from Plant et al., 2020
caudal fin neutrophil clearance increased rate, abnormal i114Tg + MO1-sema3fa amputation: caudal fin Figure 2 with image from Plant et al., 2020
cranial neural crest cell mislocalised, abnormal pbx4b557/b557 + MO1-sema3fa standard conditions Fig. 5 with image from Yu et al., 2005
neural crest cell migration disrupted, abnormal pbx4b557/b557 + MO1-sema3fa standard conditions Fig. 5 with image from Yu et al., 2005
neural crest cell migration disrupted, abnormal pbx4b557/b557 + MO1-sema3fa + MO1-sema3ga standard conditions Fig. 5 with image from Yu et al., 2005
cranial neural crest cell mislocalised, abnormal pbx4b557/b557 + MO1-sema3fa + MO1-sema3ga standard conditions Fig. 5 with image from Yu et al., 2005
caudal fin neutrophil increased amount, abnormal i114Tg + MO1-sema3fa + MO2-sema3fb amputation: caudal fin Figure 2 with image from Plant et al., 2020
caudal fin neutrophil increased amount, ameliorated i114Tg + MO1-sema3fa + MO2-sema3fb amputation: caudal fin Figure 2 with image from Plant et al., 2020
caudal fin neutrophil clearance increased rate, abnormal i114Tg + MO1-sema3fa + MO2-sema3fb amputation: caudal fin Figure 2 with image from Plant et al., 2020
dorsal longitudinal anastomotic vessel morphology, abnormal y1Tg + MO1-sema3fa + MO1-sema3fb control Fig. 6 with image from Petrova et al., 2025
whole organism viability, abnormal y1Tg + MO1-sema3fa + MO1-sema3fb control Fig. 6 with image from Petrova et al., 2025
intersegmental vein dorsal longitudinal anastomotic vessel disconnected, abnormal y1Tg + MO1-sema3fa + MO1-sema3fb control Fig. 6 with image from Petrova et al., 2025
pericardium edematous, abnormal y1Tg + MO1-sema3fa + MO1-sema3fb control Fig. 6 with image from Petrova et al., 2025
intersegmental vein angiogenic sprout mislocalised, abnormal y1Tg + MO1-sema3fa + MO1-sema3fb control Fig. 6 with image from Petrova et al., 2025
caudal vein plexus dilated, abnormal y1Tg + MO1-sema3fa + MO1-sema3fb control Fig. 6 with image from Petrova et al., 2025
intersegmental vein malformed, abnormal y1Tg + MO1-sema3fa + MO1-sema3fb control Fig. 6 with image from Petrova et al., 2025
caudal vein plexus increased accumulation blood cell, abnormal y1Tg + MO1-sema3fa + MO1-sema3fb control Fig. 6 with image from Petrova et al., 2025
Citations