Morpholino
MO1-fzd5
- ID
- ZDB-MRPHLNO-060705-6
- Name
- MO1-fzd5
- Previous Names
- Target
- Sequence
-
5' - GATGCTCGTCTGCAGGTTTCCTCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fzd5
| Expressed Gene | Anatomy | Figures |
|---|---|---|
| barhl1b |
Fig. 6
from Cavodeassi et al., 2005 |
|
| emx1 |
Fig. 6
from Cavodeassi et al., 2005 |
|
| foxa1 |
Fig. 6 
from Poulain et al., 2011 |
|
| foxb1a |
Fig. 6
from Cavodeassi et al., 2005 |
|
| hhex |
Fig. 5
from Poulain et al., 2011 |
1 - 5 of 7 Show all
Phenotype
Phenotype resulting from MO1-fzd5
1 - 3 of 3
Phenotype of all Fish created by or utilizing MO1-fzd5
1 - 5 of 6 Show all
Citations
- Liu, C., Widen, S.A., Williamson, K.A., Ratnapriya, R., Gerth-Kahlert, C., Rainger, J., Alur, R.P., Strachan, E., Manjunath, S.H., Balakrishnan, A., Floyd, J.A., Li, T., Waskiewicz, A., Brooks, B.P., Lehmann, O.J., FitzPatrick, D.R., Swaroop, A. (2016) A secreted WNT-ligand-binding domain of FZD5 generated by a frameshift mutation causes autosomal dominant coloboma. Human molecular genetics. 25(7):1382-91
- Poulain, M., and Ober, E.A. (2011) Interplay between Wnt2 and Wnt2bb controls multiple steps of early foregut-derived organ development. Development (Cambridge, England). 138(16):3557-68
- Cavodeassi, F., Carreira-Barbosa, F., Young, R., Concha, M., Allende, M.L., Houart, C., Tada, M., and Wilson, S. (2005) Early Stages of Zebrafish Eye Formation Require the Coordinated Activity of Wnt11, Fz5, and the Wnt/Catenin Pathway. Neuron. 47(1):43-56
1 - 3 of 3
Show