Morpholino

MO1-fzd8a

ID

ZDB-MRPHLNO-060705-1

Name

MO1-fzd8a

Previous Names

Target

Sequence

5' - AGTTCAGTTCAGATGTTGCAGAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-fzd8a

Expressed Gene	Anatomy	Figures
irx3a	spinal cord	Fig. 2 from Kim et al., 2008
isl2a	primary motor neuron spinal cord neural tube	Fig. 3 from Kim et al., 2008
nkx2.2a	spinal cord	Fig. 2 from Kim et al., 2008
pax2a	neural plate	Fig. 6, Fig. 7 from Cavodeassi et al., 2005
rx3	neural plate	Fig. 6, Fig. 7 from Cavodeassi et al., 2005
slc6a3	diencephalon dopaminergic neuron	Fig. 8 from Russek-Blum et al., 2008
sox10	(not) glioblast (sensu Vertebrata) spinal cord	Fig. 3 from Kim et al., 2008

Phenotype

Phenotype resulting from MO1-fzd8a

Phenotype	Fish	Figures
diencephalon dopaminergic neuron increased amount, abnormal	WT + MO1-fzd8a	Fig. 8 from Russek-Blum et al., 2008
spinal cord glioblast (sensu Vertebrata) absent, abnormal	vu12Tg + MO1-fzd8a	Fig. 3 from Kim et al., 2008
spinal cord glioblast (sensu Vertebrata) decreased amount, abnormal	vu12Tg + MO1-fzd8a	Fig. 3 from Kim et al., 2008
spinal cord radial glial cell decreased amount, abnormal	vu12Tg + MO1-fzd8a	Fig. 4 from Kim et al., 2008
spinal cord radial glial cell disorganized, abnormal	vu12Tg + MO1-fzd8a	Fig. 4 from Kim et al., 2008
spinal cord secondary motor neuron decreased amount, abnormal	vu12Tg + MO1-fzd8a	Fig. 3 from Kim et al., 2008
spinal cord motor neuron cell fate specification disrupted, abnormal	vu12Tg + MO1-fzd8a	Fig. 3 from Kim et al., 2008
spinal cord oligodendrocyte cell fate specification disrupted, abnormal	vu12Tg + MO1-fzd8a	Fig. 3 from Kim et al., 2008

Phenotype of all Fish created by or utilizing MO1-fzd8a

Phenotype	Fish	Conditions	Figures
diencephalon dopaminergic neuron increased amount, abnormal	WT + MO1-fzd8a	standard conditions	Fig. 8 from Russek-Blum et al., 2008
spinal cord radial glial cell disorganized, abnormal	vu12Tg + MO1-fzd8a	standard conditions	Fig. 4 from Kim et al., 2008
spinal cord oligodendrocyte cell fate specification disrupted, abnormal	vu12Tg + MO1-fzd8a	standard conditions	Fig. 3 from Kim et al., 2008
spinal cord radial glial cell decreased amount, abnormal	vu12Tg + MO1-fzd8a	standard conditions	Fig. 4 from Kim et al., 2008
spinal cord glioblast (sensu Vertebrata) decreased amount, abnormal	vu12Tg + MO1-fzd8a	chemical treatment: 5-bromo-2'-deoxyuridine	Fig. 4 from Kim et al., 2008
spinal cord motor neuron cell fate specification disrupted, abnormal	vu12Tg + MO1-fzd8a	standard conditions	Fig. 3 from Kim et al., 2008
spinal cord glioblast (sensu Vertebrata) decreased amount, abnormal	vu12Tg + MO1-fzd8a	standard conditions	Fig. 3 from Kim et al., 2008
spinal cord glioblast (sensu Vertebrata) absent, abnormal	vu12Tg + MO1-fzd8a	standard conditions	Fig. 3 from Kim et al., 2008
spinal cord secondary motor neuron decreased amount, abnormal	vu12Tg + MO1-fzd8a	standard conditions	Fig. 3 from Kim et al., 2008
glial cell proliferation disrupted, abnormal	vu12Tg + MO1-fzd8a	chemical treatment: 5-bromo-2'-deoxyuridine	Fig. 4 from Kim et al., 2008

Citations