header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-060626-5
Morpholino Name: MO1-rbpja
Target: rbpja (1)
Previous Names: MO1-rbpj (1), MO1-rbpsuh (1), Su(H)-5'Mo (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CGCCATCTTCACCAACTCTCTCTAA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-rbpja No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-rbpja
Expressed Gene Anatomy Figures
elavl3 Fig. 4 from Kuwabara et al., 2018
hes6 Fig. 8 from Gajewski et al., 2006
hk1 Fig. 4 from Kuwabara et al., 2018
hk2 Fig. 4 from Kuwabara et al., 2018
ldha Fig. 4 from Kuwabara et al., 2018
pkma Fig. 4 from Kuwabara et al., 2018
slc2a1a Fig. 4 from Kuwabara et al., 2018
slc2a3a Fig. 4 from Kuwabara et al., 2018
PHENOTYPE
Phenotype resulting from MO1-rbpja
Phenotype of all Fish created by or utilizing MO1-rbpja
Genome Resources:
CITATIONS (5)