Morpholino

MO1-rbpja

ID
ZDB-MRPHLNO-060626-5
Name
MO1-rbpja
Previous Names
  • MO1-rbpj (1)
  • MO1-rbpsuh (1)
  • Su(H)-5'Mo (1)
Target
Sequence
5' - CGCCATCTTCACCAACTCTCTCTAA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rbpja
Expressed Gene Anatomy Figures
elavl3 Fig. 4 from Kuwabara et al., 2018
hes6 Fig. 8 from Gajewski et al., 2006
hk1 Fig. 4 from Kuwabara et al., 2018
hk2 Fig. 4 from Kuwabara et al., 2018
ldha Fig. 4 from Kuwabara et al., 2018
pkma Fig. 4 from Kuwabara et al., 2018
slc2a1a Fig. 4 from Kuwabara et al., 2018
slc2a3a Fig. 4 from Kuwabara et al., 2018
Phenotype
Phenotype resulting from MO1-rbpja
Phenotype Fish Figures
Muller cell GFP expression absent, abnormal cu2Tg; mi6Tg + MO1-rbpja Fig. 2,  Fig. 3 from MacDonald et al., 2015
Muller cell absent, abnormal cu2Tg; mi6Tg + MO1-rbpja Fig. 2,  Fig. 3 from MacDonald et al., 2015
retinal ganglion cell layer broken, abnormal cu2Tg; mi6Tg + MO1-rbpja Fig. 3 from MacDonald et al., 2015
retinal ganglion cell layer separated from retinal neural layer, abnormal cu2Tg; mi6Tg + MO1-rbpja Fig. 3 from MacDonald et al., 2015
whole organism slc2a1a expression decreased amount, abnormal WT + MO1-rbpja Fig. 4 from Kuwabara et al., 2018
whole organism pkma expression decreased amount, abnormal WT + MO1-rbpja Fig. 4 from Kuwabara et al., 2018
whole organism slc2a3a expression decreased amount, abnormal WT + MO1-rbpja Fig. 4 from Kuwabara et al., 2018
whole organism hk2 expression increased amount, abnormal WT + MO1-rbpja Fig. 4 from Kuwabara et al., 2018
Phenotype of all Fish created by or utilizing MO1-rbpja
Phenotype Fish Conditions Figures
whole organism slc2a1a expression decreased amount, abnormal WT + MO1-rbpja standard conditions Fig. 4 from Kuwabara et al., 2018
whole organism slc2a3a expression decreased amount, abnormal WT + MO1-rbpja standard conditions Fig. 4 from Kuwabara et al., 2018
whole organism pkma expression decreased amount, abnormal WT + MO1-rbpja standard conditions Fig. 4 from Kuwabara et al., 2018
whole organism hk2 expression increased amount, abnormal WT + MO1-rbpja standard conditions Fig. 4 from Kuwabara et al., 2018
retinal ganglion cell layer separated from retinal neural layer, abnormal cu2Tg; mi6Tg + MO1-rbpja control Fig. 3 from MacDonald et al., 2015
retinal ganglion cell layer broken, abnormal cu2Tg; mi6Tg + MO1-rbpja control Fig. 3 from MacDonald et al., 2015
Muller cell GFP expression absent, abnormal cu2Tg; mi6Tg + MO1-rbpja control Fig. 2,  Fig. 3 from MacDonald et al., 2015
Muller cell absent, abnormal cu2Tg; mi6Tg + MO1-rbpja control Fig. 2,  Fig. 3 from MacDonald et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.