Morpholino

MO2-atp1b1a

ID

ZDB-MRPHLNO-060622-5

Name

MO2-atp1b1a

Previous Names

[b]1aMO-2 (1)

Target

atp1b1a (1)

Sequence

5' - CGGTATTTAGTTCCCTTTTTGGTGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-atp1b1a

No data available

Phenotype

Phenotype resulting from MO2-atp1b1a

Phenotype	Fish	Figures
epidermal cell aggregated, abnormal	WT + MO2-atp1b1a	Fig. 3 , Fig. 7 from Hatzold et al., 2016
epidermis morphology, abnormal	WT + MO2-atp1b1a	Fig. 7 from Hatzold et al., 2016
heart cardiac muscle cell action potential decreased duration, abnormal	WT + MO2-atp1b1a	Fig. 3 from Lundby et al., 2014
pericardium edematous, abnormal	WT + MO2-atp1b1a	Fig. 3 from Hatzold et al., 2016

Phenotype of all Fish created by or utilizing MO2-atp1b1a

Phenotype	Fish	Conditions	Figures
caudal fin EGFP expression spatial pattern, abnormal	sh235Tg/sh235Tg + MO2-atp1b1a	hypotonic	Fig 3 from Hatzold et al., 2023
caudal fin EGFP expression increased amount, abnormal	sh235Tg/sh235Tg + MO2-atp1b1a	hypotonic	Fig 3 from Hatzold et al., 2023
pericardium edematous, abnormal	WT + MO2-atp1b1a	standard conditions	Fig. 3 from Hatzold et al., 2016
median fin fold cell population proliferation increased process quality, abnormal	WT + MO2-atp1b1a	hypotonic	Fig. 5 from Hatzold et al., 2016
epidermal cell aggregated, abnormal	WT + MO2-atp1b1a	standard conditions	Fig. 3 , Fig. 7 from Hatzold et al., 2016
epidermis morphology, abnormal	WT + MO2-atp1b1a	standard conditions	Fig. 7 from Hatzold et al., 2016
heart cardiac muscle cell action potential decreased duration, abnormal	WT + MO2-atp1b1a	standard conditions	Fig. 3 from Lundby et al., 2014
keratinocyte EGFP expression amount, ameliorated	sh235Tg + MO2-atp1b1a	hypotonic, chemical treatment by environment: withaferin A	Fig. 9 from Hatzold et al., 2016
keratinocyte EGFP expression increased amount, abnormal	sh235Tg + MO2-atp1b1a	hypotonic	Fig. 9 from Hatzold et al., 2016
keratinocyte EGFP expression amount, ameliorated	sh235Tg + MO2-atp1b1a	hypotonic, chemical treatment by environment: wortmannin	Fig. 9 from Hatzold et al., 2016
keratinocyte EGFP expression amount, ameliorated	sh235Tg + MO2-atp1b1a	hypotonic, chemical treatment by environment: sirolimus	Fig. 9 from Hatzold et al., 2016
caudal fin EGFP expression amount, ameliorated	sh235Tg/sh235Tg + MO1-st14a + MO2-atp1b1a	hypotonic	Fig 3 from Hatzold et al., 2023
caudal fin EGFP expression spatial pattern, ameliorated	sh235Tg/sh235Tg + MO1-st14a + MO2-atp1b1a	hypotonic	Fig 3 from Hatzold et al., 2023
epidermal cell aggregated, abnormal	WT + MO1-llgl2 + MO2-atp1b1a	standard conditions	Fig. 7 from Hatzold et al., 2016
epidermis morphology, abnormal	WT + MO1-llgl2 + MO2-atp1b1a	standard conditions	Fig. 7 from Hatzold et al., 2016

Citations