header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-060608-3
Morpholino Name: MO1-slc2a1a
Target: slc2a1a (1)
Previous Names: MO1-slc2a1, glut1 start MO

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GGCCATCATCAGCTGAGGAGTCACC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-slc2a1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-slc2a1a
Expressed Gene Anatomy Figures
slc2a1a Fig. 7 from Jensen et al., 2010
PHENOTYPE
Phenotype resulting from MO1-slc2a1a
Phenotype of all Fish created by or utilizing MO1-slc2a1a
Genome Resources:
CITATIONS (4)