Morpholino

MO1-sparc

ID

ZDB-MRPHLNO-060601-6

Name

MO1-sparc

Previous Names

Target

Sequence

5' - ATCTTGAGTTTCAGCCTTCTGTCCG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-sparc

Expressed Gene	Anatomy	Figures
sparc	whole organism	Fig. 3 from Kang et al., 2008

Phenotype

Phenotype resulting from MO1-sparc

Phenotype	Fish	Figures
blood cell decreased amount, abnormal	WT + MO1-sparc	Fig. Table 1, Fig. Table S7 from Eckfeldt et al., 2005
blood circulation arrested, abnormal	sd2Tg; y1Tg + MO1-sparc	Fig. Table S7 from Eckfeldt et al., 2005
caudal fin kinked, abnormal	sd2Tg; y1Tg + MO1-sparc	Fig. Table S7 from Eckfeldt et al., 2005
embryonic hemopoiesis disrupted, abnormal	WT + MO1-sparc	Fig. Table 1, Fig. Table S7 from Eckfeldt et al., 2005
head apoptotic, abnormal	sd2Tg; y1Tg + MO1-sparc	Fig. Table S7 from Eckfeldt et al., 2005
otolith composition, abnormal	WT + MO1-sparc	Fig. 4 from Kang et al., 2008
otolith decreased size, abnormal	WT + MO1-sparc	Fig. 4 from Kang et al., 2008
otolith fused with otolith, abnormal	WT + MO1-sparc	Fig. 4 from Kang et al., 2008

Phenotype of all Fish created by or utilizing MO1-sparc

Phenotype	Fish	Conditions	Figures
otolith composition, abnormal	WT + MO1-sparc	standard conditions	Fig. 4 from Kang et al., 2008
embryonic hemopoiesis disrupted, abnormal	WT + MO1-sparc	standard conditions	Fig. Table 1 from Eckfeldt et al., 2005
otolith fused with otolith, abnormal	WT + MO1-sparc	standard conditions	Fig. 4 from Kang et al., 2008
blood cell decreased amount, abnormal	WT + MO1-sparc	standard conditions	Fig. Table 1 from Eckfeldt et al., 2005
otolith decreased size, abnormal	WT + MO1-sparc	standard conditions	Fig. 4 from Kang et al., 2008
blood cell decreased amount, abnormal	sd2Tg; y1Tg + MO1-sparc	standard conditions	Fig. Table S7 from Eckfeldt et al., 2005
head apoptotic, abnormal	sd2Tg; y1Tg + MO1-sparc	standard conditions	Fig. Table S7 from Eckfeldt et al., 2005
embryonic hemopoiesis disrupted, abnormal	sd2Tg; y1Tg + MO1-sparc	standard conditions	Fig. Table S7 from Eckfeldt et al., 2005
blood circulation arrested, abnormal	sd2Tg; y1Tg + MO1-sparc	standard conditions	Fig. Table S7 from Eckfeldt et al., 2005
caudal fin kinked, abnormal	sd2Tg; y1Tg + MO1-sparc	standard conditions	Fig. Table S7 from Eckfeldt et al., 2005

Citations