Morpholino

MO1-smyd1b

ID
ZDB-MRPHLNO-060524-9
Name
MO1-smyd1b
Previous Names
  • ATG-MO smyd1 (1)
Target
Sequence
5' - ACTTCCACAAACTCCATTCTGGATC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The sequence of this morpholino as reported by Tan, X. et al. (2006) contained a typographical error. The correct morpholino sequence, shown above, has been confirmed by the authors.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-smyd1b
Expressed Gene Anatomy Figures
hsp90aa1.1 Fig. 5 from Li et al., 2013
myf5 Fig. S9 from Tan et al., 2006
myhz2 Fig. 8 from Li et al., 2013
myod1 Fig. S9 from Tan et al., 2006
myog Fig. S9 from Tan et al., 2006
smyhc1 Fig. 8 from Li et al., 2013
Fig. 3 from Xu et al., 2012
trim55a Fig. 5 from Li et al., 2019
trim63a Fig. 5 from Li et al., 2019
unc45b Fig. 5 from Li et al., 2013
Phenotype
Phenotype resulting from MO1-smyd1b
Phenotype Fish Figures
cardiac muscle cell Z disc disorganized, abnormal WT + MO1-smyd1b Fig. 4 from Li et al., 2013
cardiac muscle myosin thick filament assembly disrupted, abnormal WT + MO1-smyd1b Fig. 4 from Li et al., 2013
fast muscle cell M band disorganized, abnormal WT + MO1-smyd1b Fig. 2 from Li et al., 2013
fast muscle cell muscle thin filament assembly disrupted, abnormal WT + MO1-smyd1b Fig. 2 from Li et al., 2013
fast muscle cell sarcomere organization disrupted, abnormal WT + MO1-smyd1b Fig. 2 from Li et al., 2013
fast muscle cell striated muscle myosin thick filament assembly disrupted, abnormal WT + MO1-smyd1b Fig. 2 from Li et al., 2013
fast muscle cell Z disc disorganized, abnormal WT + MO1-smyd1b Fig. 2 from Li et al., 2013
skeletal muscle striated muscle thin filament disorganized, abnormal WT + MO1-smyd1b Fig. 4 with image from Gao et al., 2014
slow muscle cell myofibril assembly disrupted, abnormal WT + MO1-smyd1b Fig. 1 from Li et al., 2013
slow muscle cell myosin filament disorganized, abnormal WT + MO1-smyd1b Fig. 3 with image from Gao et al., 2014
slow muscle cell Z disc disorganized, abnormal WT + MO1-smyd1b Fig. 5 with image from Gao et al., 2014
Phenotype of all Fish created by or utilizing MO1-smyd1b
Phenotype Fish Conditions Figures
fast muscle cell Z disc disorganized, abnormal WT + MO1-smyd1b standard conditions Fig. 2 from Li et al., 2013
slow muscle cell myosin filament disorganized, abnormal WT + MO1-smyd1b standard conditions Fig. 3 with image from Gao et al., 2014
skeletal muscle striated muscle thin filament disorganized, abnormal WT + MO1-smyd1b standard conditions Fig. 4 with image from Gao et al., 2014
fast muscle cell M band disorganized, abnormal WT + MO1-smyd1b standard conditions Fig. 2 from Li et al., 2013
fast muscle cell muscle thin filament assembly disrupted, abnormal WT + MO1-smyd1b standard conditions Fig. 2 from Li et al., 2013
slow muscle cell Z disc disorganized, abnormal WT + MO1-smyd1b standard conditions Fig. 5 with image from Gao et al., 2014
fast muscle cell striated muscle myosin thick filament assembly disrupted, abnormal WT + MO1-smyd1b standard conditions Fig. 2 from Li et al., 2013
slow muscle cell myofibril assembly disrupted, abnormal WT + MO1-smyd1b standard conditions Fig. 1 from Li et al., 2013
cardiac muscle myosin thick filament assembly disrupted, abnormal WT + MO1-smyd1b standard conditions Fig. 4 from Li et al., 2013
cardiac muscle cell Z disc disorganized, abnormal WT + MO1-smyd1b standard conditions Fig. 4 from Li et al., 2013
fast muscle cell sarcomere organization disrupted, abnormal WT + MO1-smyd1b standard conditions Fig. 2 from Li et al., 2013
skeletal muscle striated muscle thin filament disorganized, abnormal WT + MO1-smyd1a + MO1-smyd1b standard conditions Fig. 4 with image from Gao et al., 2014
slow muscle cell Z disc disorganized, abnormal WT + MO1-smyd1a + MO1-smyd1b standard conditions Fig. 5 with image from Gao et al., 2014
slow muscle cell myosin filament disorganized, abnormal WT + MO1-smyd1a + MO1-smyd1b standard conditions Fig. 3 with image from Gao et al., 2014
skeletal muscle cell EGFP expression spatial pattern, abnormal mb19Tg + MO1-smyd1b standard conditions Fig. 6 from Li et al., 2019
skeletal muscle cell M band EGFP expression absent, abnormal mb19Tg + MO1-smyd1b standard conditions Fig. 6 from Li et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.