Morpholino
MO2-smyd1b
- ID
- ZDB-MRPHLNO-060524-10
- Name
- MO2-smyd1b
- Previous Names
-
- E9I9-MO (1)
- Target
- Sequence
-
5' - CGTCACCTCTAGGTCTTTAGTGATG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice blocker.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-smyd1b
No data available
Phenotype
Phenotype resulting from MO2-smyd1b
No data available
Phenotype of all Fish created by or utilizing MO2-smyd1b
No data available
Citations
- Li, H., Zhong, Y., Wang, Z., Gao, J., Xu, J., Chu, W., Zhang, J., Fang, S., and Du, S.J. (2013) Smyd1b is required for skeletal and cardiac muscle function in zebrafish. Molecular biology of the cell. 24(22):3511-21
- Li, H., Xu, J., Bian, Y.H., Rotllant, P., Shen, T., Chu, W., Zhang, J., Schneider, M., and Du, S.J. (2011) Smyd1b_tv1, a Key Regulator of Sarcomere Assembly, Is Localized on the M-Line of Skeletal Muscle Fibers. PLoS One. 6(12):e28524
- Tan, X., Rotllant, J., Li, H., Dedeyne, P., and Du, S.J. (2006) SmyD1, a histone methyltransferase, is required for myofibril organization and muscle contraction in zebrafish embryos. Proceedings of the National Academy of Sciences of the United States of America. 103(8):2713-2718
1 - 3 of 3
Show