Morpholino

MO1-flt4

ID
ZDB-MRPHLNO-060515-1
Name
MO1-flt4
Previous Names
  • Flt4 SD1 MO (1)
Target
Sequence
5' - TTAGGAAAATGCGTTCTCACCTGAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Overlaps the exon 1 splice donor site.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-flt4
No data available
Phenotype
Phenotype resulting from MO1-flt4
Phenotype of all Fish created by or utilizing MO1-flt4
Phenotype Fish Conditions Figures
intersegmental vessel absent, abnormal y1Tg/y1Tg + MO1-flt4 standard conditions Fig. 7 with image from Gore et al., 2011
angiogenesis disrupted, abnormal y1Tg/y1Tg + MO1-flt4 standard conditions Fig. 7 with image from Gore et al., 2011
venous blood vessel morphogenesis disrupted, abnormal WT + MO1-flt4 standard conditions Fig. 3 from Herbert et al., 2009
selective angioblast sprouting disrupted, abnormal WT + MO1-flt4 standard conditions Fig. 3 from Herbert et al., 2009
intersegmental vessel blood vessel endothelial cell decreased amount, abnormal y7Tg + MO1-flt4 standard conditions Fig. S5 from Siekmann et al., 2007
intersegmental artery blood vessel endothelial cell decreased amount, abnormal y7Tg + MO1-flt4 standard conditions Fig. 3 from Siekmann et al., 2007
motor neuron axon guidance process quality, abnormal ml2Tg; ncv1Tg + MO1-flt4 standard conditions Fig. 6 with image from Kwon et al., 2013
angiogenesis disrupted, abnormal y1Tg/y1Tg + MO1-flt4 + MO3-rspo1 standard conditions Fig. 7 with image from Gore et al., 2011
intersegmental vessel absent, abnormal y1Tg/y1Tg + MO1-flt4 + MO3-rspo1 standard conditions Fig. 7 with image from Gore et al., 2011
venous blood vessel morphogenesis disrupted, abnormal WT + MO1-flt4 + MO3-plcg1 standard conditions Fig. 3 from Herbert et al., 2009
intersegmental vessel aplastic, abnormal WT + MO1-flt4 + MO3-plcg1 standard conditions Fig. 3 from Herbert et al., 2009
intersegmental vessel decreased length, abnormal y1Tg + MO1-flt4 + MO1-mir221 standard conditions Fig. 2 with image from Nicoli et al., 2012
trunk vasculature branchiness, abnormal sars1ko095/ko095; y1Tg + MO1-flt4 standard conditions Fig. 5 from Fukui et al., 2009
Citations