Morpholino
MO2-ctnnb1
- ID
- ZDB-MRPHLNO-060414-1
- Name
- MO2-ctnnb1
- Previous Names
-
- b-catenin-1 MO1 (1)
- Target
- Sequence
-
5' - CTGGGTAGCCATGATTTTCTCACAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ctnnb1
Expressed Gene | Anatomy | Figures |
---|---|---|
chrd |
Fig. 2 ![]() Fig. 7 ![]() |
|
dharma |
|
Fig. 5 ![]() ![]() |
egr2b |
Fig. 6 ![]() |
|
emx1 |
Fig. 6 ![]() |
|
gsc |
Fig. 7 ![]() |
|
hoxb6b |
Fig. 6 ![]() |
|
isl1a |
Fig. 6 ![]() |
|
myod1 |
Fig. 6 ![]() |
|
ndr1 |
Fig. 5 ![]() ![]() |
|
nog1 |
|
Fig. 2 ![]() |
Phenotype
Phenotype resulting from MO2-ctnnb1
Phenotype of all Fish created by or utilizing MO2-ctnnb1
Citations
- Cunningham, C.M., Bellipanni, G., Habas, R., Balciunas, D. (2020) Deletion of morpholino binding sites (DeMOBS) to assess specificity of morphant phenotypes. Scientific Reports. 10:15366
- Yang, X., Gu, Q., Lin, L., Li, S., Zhong, S., Li, Q., Cui, Z. (2015) Nucleoporin 62-like protein activates canonical Wnt signaling through facilitating the nuclear import of β-catenin in zebrafish. Molecular and cellular biology. 35(7):1110-24
- Liu, J.X., Zhang, D., Xie, X., Ouyang, G., Liu, X., Sun, Y., and Xiao, W. (2013) Eaf1 and Eaf2 negatively regulate canonical Wnt/β-catenin signaling. Development (Cambridge, England). 140(5):1067-1078
- Li, Y., Li, Q., Long, Y., and Cui, Z. (2011) Lzts2 Regulates Embryonic Cell Movements and Dorsoventral Patterning through Interaction with and Export of Nuclear β-Catenin in Zebrafish. The Journal of biological chemistry. 286(52):45116-30
- Varga, M., Maegawa, S., and Weinberg, E.S. (2011) Correct anteroposterior patterning of the zebrafish neurectoderm in the absence of the early dorsal organizer. BMC Developmental Biology. 11(1):26
- Xie, X.W., Liu, J.X., Hu, B., and Xiao, W. (2011) Zebrafish foxo3b Negatively Regulates Canonical Wnt Signaling to Affect Early Embryogenesis. PLoS One. 6(9):e24469
- Varga, M., Maegawa, S., Bellipanni, G., and Weinberg, E.S. (2007) Chordin expression, mediated by Nodal and FGF signaling, is restricted by redundant function of two beta-catenins in the zebrafish embryo. Mechanisms of Development. 124(9-10):775-791
- Bellipanni, G., Varga, M., Maegawa, S., Imai, Y., Kelly, C., Myers, A.P., Chu, F., Talbot, W.S., and Weinberg, E.S. (2006) Essential and opposing roles of zebrafish β-catenins in the formation of dorsal axial structures and neurectoderm. Development (Cambridge, England). 133(7):1299-1309
1 - 8 of 8
Show