Morpholino

MO7-tal1

ID

ZDB-MRPHLNO-060405-1

Name

MO7-tal1

Previous Names

Target

Sequence

5' - GCTCGGATTTCAGTTTTTCCATCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation blocking Morpholino.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO7-tal1

Expressed Gene	Anatomy	Figures
dlc	artery	Fig. S2 from Qian et al., 2007
etsrp	lateral mesoderm	Fig. 7 from Sumanas et al., 2006
gata1a	intermediate cell mass of mesoderm (not) lateral mesoderm lateral plate mesoderm	Fig. 4 from Xiong et al., 2008 Fig. 3 from Qian et al., 2007 Fig. 7 from Sumanas et al., 2006
hbbe1.1	intermediate cell mass of mesoderm	Fig. 3 from Qian et al., 2007
hey2	artery	Fig. S2 from Qian et al., 2007
myb	hematopoietic stem cell ventral wall of dorsal aorta	Fig. 6 from Zhen et al., 2013 Fig. 6 from Qian et al., 2007
pax2a	intermediate mesoderm	Fig. S5 from Mudumana et al., 2008
rag1	T cell	Fig. S6 from Zhen et al., 2013 Fig. 6 from Qian et al., 2007
runx1	ventral wall of dorsal aorta	Fig. 6 from Qian et al., 2007
spi1b	(not) erythroid lineage cell macrophage	Fig. 4 from Sumanas et al., 2008 Fig. 3 from Qian et al., 2007
tal1	intermediate cell mass of mesoderm	Fig. 3 from Qian et al., 2007

Phenotype

Phenotype resulting from MO7-tal1

Phenotype	Fish	Figures
hematopoietic stem cell apoptotic, abnormal	hkz07tTg; s843Tg + MO7-tal1	Fig. 6 from Zhen et al., 2013
hematopoietic stem cell decreased amount, abnormal	WT + MO7-tal1	Fig. 6 from Zhen et al., 2013
hemoglobin biosynthetic process disrupted, abnormal	WT + MO7-tal1	Fig. 4 from Qian et al., 2007
nucleate erythrocyte decreased amount, abnormal	WT + MO7-tal1	Fig. 4 from Qian et al., 2007
nucleate erythrocyte immature, abnormal	WT + MO7-tal1	Fig. 4 from Qian et al., 2007

Phenotype of all Fish created by or utilizing MO7-tal1

Phenotype	Fish	Conditions	Figures
nucleate erythrocyte immature, abnormal	WT + MO7-tal1	standard conditions	Fig. 4 from Qian et al., 2007
hemoglobin biosynthetic process disrupted, abnormal	WT + MO7-tal1	standard conditions	Fig. 4 from Qian et al., 2007
nucleate erythrocyte decreased amount, abnormal	WT + MO7-tal1	standard conditions	Fig. 4 from Qian et al., 2007
hematopoietic stem cell decreased amount, abnormal	WT + MO7-tal1	standard conditions	Fig. 6 from Zhen et al., 2013
hematopoietic stem cell apoptotic, abnormal	hkz07tTg; s843Tg + MO7-tal1	standard conditions	Fig. 6 from Zhen et al., 2013

Citations