Morpholino
MO2-fgf24
- ID
- ZDB-MRPHLNO-060328-4
- Name
- MO2-fgf24
- Previous Names
-
- fgf24 MO (1)
- Target
- Sequence
-
5' - GACGGCAGAACAGACATCTTGGTCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-fgf24
Expressed Gene | Anatomy | Figures |
---|---|---|
fgfr2 |
Fig. 6 ![]() |
|
phox2a | (all 4) |
Fig. 6 ![]() |
prdm1a |
|
Fig. 5 ![]() |
sall1a |
Fig. 4 ![]() |
|
sall4 |
Fig. 2 ![]() |
1 - 5 of 7 Show all
Phenotype
Phenotype resulting from MO2-fgf24
1 - 3 of 3
Phenotype of all Fish created by or utilizing MO2-fgf24
1 - 3 of 3
Citations
- Mao, Q., Stinnett, H.K., Ho, R.K. (2015) Asymmetric cell convergence-driven fin bud initiation and pre-pattern requires Tbx5a control of a mesenchymal Fgf signal. Development (Cambridge, England). 142(24):4329-39
- Maulding, K., Padanad, M.S., Dong, J., Riley, B.B. (2014) Mesodermal Fgf10b cooperates with other Fgfs during induction of otic and epibranchial placodes in zebrafish. Developmental Dynamics : an official publication of the American Association of Anatomists. 243(10):1275-85
- Green, M.H., Ho, R.K., and Hale, M.E. (2011) Movement and function of the pectoral fins of the larval zebrafish (Danio rerio) during slow swimming. The Journal of experimental biology. 214(18):3111-3123
- Padanad, M.S., and Riley, B.B. (2011) Pax2/8 proteins coordinate sequential induction of otic and epibranchial placodes through differential regulation of foxi1, sox3 and fgf24. Developmental Biology. 351(1):90-98
- Simões, F.C., Peterkin, T., and Patient, R. (2011) Fgf differentially controls cross-antagonism between cardiac and haemangioblast regulators. Development (Cambridge, England). 138(15):3235-3245
- Harvey, S.A., and Logan, M.P. (2006) sall4 acts downstream of tbx5 and is required for pectoral fin outgrowth. Development (Cambridge, England). 133(6):1165-1173
- Lee, B.C., and Roy, S. (2006) Blimp-1 is an essential component of the genetic program controlling development of the pectoral limb bud. Developmental Biology. 300(2):623-634
- Poulain, M., Fürthauer, M., Thisse, B., Thisse, C., and Lepage, T. (2006) Zebrafish endoderm formation is regulated by combinatorial Nodal, FGF and BMP signalling. Development (Cambridge, England). 133(11):2189-2200
- Fischer, S., Draper, B.W., and Neumann, C.J. (2003) The zebrafish fgf24 mutant identifies an additional level of Fgf signaling involved in vertebrate forelimb initiation. Development (Cambridge, England). 130(15):3515-3524
1 - 9 of 9
Show