Morpholino
MO1-sall4
- ID
- ZDB-MRPHLNO-060328-1
- Name
- MO1-sall4
- Previous Names
-
- sall4 MO (1)
- Target
- Sequence
-
5' - CGCTCCAAACTCACCATTTTCTGTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO affecting pectoral fin outgrowth.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-sall4
Expressed Gene | Anatomy | Figures |
---|---|---|
dlx2a |
Fig. 3 ![]() |
|
drl |
Fig. 4 ![]() |
|
etv5b |
Fig. 3 ![]() |
|
fgf10a |
Fig. 3 ![]() |
|
fgf24 |
|
Fig. 3 ![]() |
fli1 |
Fig. 4 ![]() |
|
gata1a |
Fig. 3 ![]() |
|
lmo2 |
Fig. 4 ![]() |
|
myod1 |
Fig. 4 ![]() |
|
pax2a |
Fig. 4 ![]() |
|
pou5f3 |
Fig. 6,
Fig. 7
from Dong et al., 2017 |
|
znfl1c |
Fig. 6
from Dong et al., 2017 |
|
znfl1g |
Fig. 6
from Dong et al., 2017 |
|
znfl1l |
Fig. 6
from Dong et al., 2017 |
|
znfl1h |
Fig. 6
from Dong et al., 2017 |
|
znfl1b |
Fig. 6
from Dong et al., 2017 |
|
znfl1j |
Fig. 6
from Dong et al., 2017 |
|
znfl1i |
Fig. 6
from Dong et al., 2017 |
|
znfl1k |
Fig. 6
from Dong et al., 2017 |
|
sp9 |
Fig. 3 ![]() |
|
tal1 |
Fig. 4 ![]() |
|
tbx16 |
Fig. 4 ![]() |
|
znfl1 |
Fig. 6
from Dong et al., 2017 |
Phenotype
Phenotype resulting from MO1-sall4
Phenotype | Fish | Figures |
---|---|---|
whole organism pou5f3 expression decreased amount, abnormal | WT + MO1-sall4 |
Fig. 6,
Fig. 7
from Dong et al., 2017 |
Phenotype of all Fish created by or utilizing MO1-sall4
Citations