Morpholino
MO1-sall4
- ID
- ZDB-MRPHLNO-060328-1
- Name
- MO1-sall4
- Previous Names
-
- sall4 MO (1)
- Target
- Sequence
-
5' - CGCTCCAAACTCACCATTTTCTGTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO affecting pectoral fin outgrowth.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-sall4
| Expressed Gene | Anatomy | Figures |
|---|---|---|
| dlx2a |
Fig. 3 
from Harvey et al., 2006 |
|
| drl |
Fig. 4
from Paik et al., 2013 |
|
| etv5b |
Fig. 3
from Harvey et al., 2006 |
|
| fgf10a |
Fig. 3
from Harvey et al., 2006 |
|
| fgf24 |
|
Fig. 3
from Harvey et al., 2006 |
| fli1 |
Fig. 4
from Paik et al., 2013 |
|
| gata1a |
Fig. 3
from Paik et al., 2013 |
|
| lmo2 |
Fig. 4
from Paik et al., 2013 |
|
| myod1 |
Fig. 4
from Paik et al., 2013 |
|
| pax2a |
Fig. 4
from Paik et al., 2013 |
|
| pou5f3 |
Fig. 6,
Fig. 7
from Dong et al., 2017 |
|
| znfl1c |
Fig. 6
from Dong et al., 2017 |
|
| znfl1g |
Fig. 6
from Dong et al., 2017 |
|
| znfl1l |
Fig. 6
from Dong et al., 2017 |
|
| znfl1h |
Fig. 6
from Dong et al., 2017 |
|
| znfl1b |
Fig. 6
from Dong et al., 2017 |
|
| znfl1j |
Fig. 6
from Dong et al., 2017 |
|
| znfl1i |
Fig. 6
from Dong et al., 2017 |
|
| znfl1k |
Fig. 6
from Dong et al., 2017 |
|
| sp9 |
Fig. 3
from Harvey et al., 2006 |
|
| tal1 |
Fig. 4
from Paik et al., 2013 |
|
| tbx16 |
Fig. 4
from Paik et al., 2013 |
|
| znfl1 |
Fig. 6
from Dong et al., 2017 |
Phenotype
Phenotype resulting from MO1-sall4
| Phenotype | Fish | Figures |
|---|---|---|
| whole organism pou5f3 expression decreased amount, abnormal | WT + MO1-sall4 |
Fig. 6,
Fig. 7
from Dong et al., 2017 |
Phenotype of all Fish created by or utilizing MO1-sall4
Citations
- Wang, W., Yang, N., Wang, L., Zhu, Y., Chu, X., Xu, W., Li, Y., Xu, Y., Gao, L., Zhang, B., Zhang, G., Sun, Q., Wang, W., Wang, Q., Zhang, W., Chen, D. (2024) The TET-Sall4-BMP regulatory axis controls craniofacial cartilage development. Cell Reports. 43:113873113873
- Dong, X., Li, J., He, L., Gu, C., Jia, W., Yue, Y., Li, J., Zhang, Q., Chu, L., Zhao, Q. (2017) Zebrafish Znfl1 proteins control the expression of hoxb1b gene in the posterior neuroectoderm by acting upstream of pou5f3 and sall4 genes.. The Journal of biological chemistry. 292(31):13045-13055
- Paik, E.J., Mahony, S., White, R.M., Price, E.N., Dibiase, A., Dorjsuren, B., Mosimann, C., Davidson, A.J., Gifford, D., and Zon, L.I. (2013) A cdx4-sall4 regulatory module controls the transition from mesoderm formation to embryonic hematopoiesis. Stem Cell Reports. 1(5):425-436
- Harvey, S.A., and Logan, M.P. (2006) sall4 acts downstream of tbx5 and is required for pectoral fin outgrowth. Development (Cambridge, England). 133(6):1165-1173
1 - 4 of 4
Show