Morpholino
MO1-slc25a37
- ID
- ZDB-MRPHLNO-060320-4
- Name
- MO1-slc25a37
- Previous Names
- None
- Target
- Sequence
-
5' - TAAGTTGCATTACCTTGACTGAATC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-slc25a37
No data available
Phenotype
Phenotype resulting from MO1-slc25a37
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO1-slc25a37
1 - 3 of 3
Citations
- Grillo, A.S., SantaMaria, A.M., Kafina, M.D., Cioffi, A.G., Huston, N.C., Han, M., Seo, Y.A., Yien, Y.Y., Nardone, C., Menon, A.V., Fan, J., Svoboda, D.C., Anderson, J.B., Hong, J.D., Nicolau, B.G., Subedi, K., Gewirth, A.A., Wessling-Resnick, M., Kim, J., Paw, B.H., Burke, M.D. (2017) Restored iron transport by a small molecule promotes absorption and hemoglobinization in animals. Science (New York, N.Y.). 356:608-616
- Davuluri, G., Song, P., Liu, Z., Wald, D., Sakaguchi, T.F., Green, M.R., Devireddy, L. (2016) Inactivation of 3-hydroxybutyrate dehydrogenase 2 delays zebrafish erythroid maturation by conferring premature mitophagy. Proceedings of the National Academy of Sciences of the United States of America. 113(11):E1460-9
- Shaw, G.C., Cope, J.J., Li, L., Corson, K., Hersey, C., Ackermann, G.E., Gwynn, B., Lambert, A.J., Wingert, R.A., Traver, D., Trede, N.S., Barut, B.A., Zhou, Y., Minet, E., Donovan, A., Brownlie, A., Balzan, R., Weiss, M.J., Peters, L.L., Kaplan, J., Zon, L.I., and Paw, B.H. (2006) Mitoferrin is essential for erythroid iron assimilation. Nature. 440(7080):96-100
1 - 3 of 3
Show