Morpholino
MO2-ttc8
- ID
- ZDB-MRPHLNO-060301-2
- Name
- MO2-ttc8
- Previous Names
-
- bbs8SpliceMO (1)
- Target
- Sequence
-
5' - AGCTGTATACTCACGAGCCACCTGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ttc8
Expressed Gene | Anatomy | Figures |
---|---|---|
myod1 |
Fig. 7
from Hudak et al., 2010 |
|
pax2a |
Fig. 7
from Hudak et al., 2010 |
1 - 2 of 2
Phenotype
Phenotype resulting from MO2-ttc8
Phenotype | Fish | Figures |
---|---|---|
gastrulation disrupted, abnormal | WT + MO2-ttc8 |
Table S4
from Lindstrand et al., 2016 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO2-ttc8
1 - 2 of 2
Citations
- Lindstrand, A., Frangakis, S., Carvalho, C.M., Richardson, E.B., McFadden, K.A., Willer, J.R., Pehlivan, D., Liu, P., Pediaditakis, I.L., Sabo, A., Lewis, R.A., Banin, E., Lupski, J.R., Davis, E.E., Katsanis, N. (2016) Copy-Number Variation Contributes to the Mutational Load of Bardet-Biedl Syndrome. American journal of human genetics. 99:318-336
- Hudak, L.M., Lunt, S., Chang, C.H., Winkler, E., Flammer, H., Lindsey, M., and Perkins, B. (2010) The Intraflagellar Transport Protein Ift80 is essential for Photoreceptor Survival in a Zebrafish Model of Jeune Asphyxiating Thoracic Dystrophy. Investigative ophthalmology & visual science. 51(7):3792-3799
- Yen, H.J., Tayeh, M.K., Mullins, R.F., Stone, E.M., Sheffield, V.C., and Slusarski, D.C. (2006) Bardet-Biedl syndrome genes are important in retrograde intracellular trafficking and Kupffer's vesicle cilia function. Human molecular genetics. 15(5):667-677
1 - 3 of 3
Show