ZFIN ID: ZDB-MRPHLNO-060220-2
Morpholino Name: MO2-ptges
Target: ptges (1)
Sequence:
5' - GTTTTGTGCTCTTACCTCCTACAGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: splice-blocker targeted to first intron-exon boundary
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-ptges No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-ptges
Expressed Gene Anatomy Figures
ptges Sup. Fig. 2 with image from Cha et al., 2006
six3b Fig. 2 with image from Cha et al., 2006
tbxta Fig. 2 with image from Cha et al., 2006
PHENOTYPE
Phenotype resulting from MO2-ptges
Phenotype Figures
axis decreased length, abnormal Fig. 2 with imageSup. Fig. 1 from Cha et al., 2006
convergent extension involved in gastrulation delayed, abnormal Fig. 2 with image from Cha et al., 2006
epiboly involved in gastrulation with mouth forming second arrested, abnormal Fig. 2 with image from Cha et al., 2006
epiboly involved in gastrulation with mouth forming second delayed, abnormal Fig. 2 with imageSup. Fig. 1 from Cha et al., 2006
head position, abnormal Fig. 2 with imageSup. Fig. 1 from Cha et al., 2006
notochord increased width, abnormal Fig. 2 with image from Cha et al., 2006
whole organism viability, abnormal Sup. Fig. 1 from Cha et al., 2006

Phenotype of all Fish created by or utilizing MO2-ptges
Phenotype Fish Conditions Figures
head position, abnormal WT + MO2-ptges standard conditions Fig. 2 with imageSup. Fig. 1 from Cha et al., 2006
epiboly involved in gastrulation with mouth forming second arrested, abnormal WT + MO2-ptges standard conditions Fig. 2 with image from Cha et al., 2006
convergent extension involved in gastrulation delayed, abnormal WT + MO2-ptges standard conditions Fig. 2 with image from Cha et al., 2006
notochord increased width, abnormal WT + MO2-ptges standard conditions Fig. 2 with image from Cha et al., 2006
epiboly involved in gastrulation with mouth forming second delayed, abnormal WT + MO2-ptges standard conditions Fig. 2 with imageSup. Fig. 1 from Cha et al., 2006
whole organism viability, abnormal WT + MO2-ptges standard conditions Sup. Fig. 1 from Cha et al., 2006
axis decreased length, abnormal WT + MO2-ptges standard conditions Fig. 2 with imageSup. Fig. 1 from Cha et al., 2006
OTHER MO2-ptges MORPHOLINO PAGESNo links to external sites
CITATIONS (9)