Morpholino

MO2-ptges

ID

ZDB-MRPHLNO-060220-2

Name

MO2-ptges

Previous Names

None

Target

Sequence

5' - GTTTTGTGCTCTTACCTCCTACAGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

splice-blocker targeted to first intron-exon boundary

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-ptges

Phenotype

Phenotype resulting from MO2-ptges

Phenotype	Fish	Figures
axis decreased length, abnormal	WT + MO2-ptges	Fig. 2 , Sup. Fig. 1 from Cha et al., 2006
convergent extension involved in gastrulation delayed, abnormal	WT + MO2-ptges	Fig. 2 from Cha et al., 2006
epiboly involved in gastrulation with mouth forming second arrested, abnormal	WT + MO2-ptges	Fig. 2 from Cha et al., 2006
epiboly involved in gastrulation with mouth forming second delayed, abnormal	WT + MO2-ptges	Fig. 2 , Sup. Fig. 1 from Cha et al., 2006
head position, abnormal	WT + MO2-ptges	Fig. 2 , Sup. Fig. 1 from Cha et al., 2006
notochord increased width, abnormal	WT + MO2-ptges	Fig. 2 from Cha et al., 2006
whole organism viability, abnormal	WT + MO2-ptges	Sup. Fig. 1 from Cha et al., 2006
whole organism neutrophil decreased amount, abnormal	i114Tg + MO2-ptges	Fig. 3 from Loynes et al., 2018

Phenotype of all Fish created by or utilizing MO2-ptges

Phenotype	Fish	Conditions	Figures
head position, abnormal	WT + MO2-ptges	standard conditions	Fig. 2 , Sup. Fig. 1 from Cha et al., 2006
epiboly involved in gastrulation with mouth forming second arrested, abnormal	WT + MO2-ptges	standard conditions	Fig. 2 from Cha et al., 2006
convergent extension involved in gastrulation delayed, abnormal	WT + MO2-ptges	standard conditions	Fig. 2 from Cha et al., 2006
notochord increased width, abnormal	WT + MO2-ptges	standard conditions	Fig. 2 from Cha et al., 2006
epiboly involved in gastrulation with mouth forming second delayed, abnormal	WT + MO2-ptges	standard conditions	Fig. 2 , Sup. Fig. 1 from Cha et al., 2006
whole organism viability, abnormal	WT + MO2-ptges	standard conditions	Sup. Fig. 1 from Cha et al., 2006
axis decreased length, abnormal	WT + MO2-ptges	standard conditions	Fig. 2 , Sup. Fig. 1 from Cha et al., 2006
caudal fin neutrophil increased amount, abnormal	i114Tg + MO2-ptges	transection: caudal fin	Fig. 3 from Loynes et al., 2018
whole organism neutrophil decreased amount, abnormal	i114Tg + MO2-ptges	control	Fig. 3 from Loynes et al., 2018

Citations