Morpholino

MO1-lef1

ID
ZDB-MRPHLNO-060214-5
Name
MO1-lef1
Previous Names
None
Target
Sequence
5' - CTCCTCCACCTGACAACTGCGGCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-lef1
No data available
Phenotype
Phenotype resulting from MO1-lef1
Phenotype Fish Figures
cartilage morphogenesis disrupted, abnormal WT + MO1-lef1 Fig. 1 from Ishitani et al., 2005
caudal fin morphology, abnormal WT + MO1-lef1 Fig. 1 from Ishitani et al., 2005
cranial cartilage morphology, abnormal WT + MO1-lef1 Fig. 1 from Ishitani et al., 2005
dorsal root ganglion decreased amount, abnormal WT + MO1-lef1 Fig. 1 from Ishitani et al., 2005
dorsal root ganglion mislocalised, abnormal WT + MO1-lef1 Fig. 1 from Ishitani et al., 2005
melanocyte decreased amount, abnormal WT + MO1-lef1 Fig. 3 from Ishitani et al., 2005
neural crest cell development disrupted, abnormal WT + MO1-lef1 Fig. 1 from Ishitani et al., 2005
neural crest cell migration disrupted, abnormal WT + MO1-lef1 Fig. 2 from Ishitani et al., 2005
paraxial mesoderm decreased size, abnormal WT + MO1-lef1 Fig. 2 with image from Dorsky et al., 2002
pigment cell differentiation disrupted, abnormal WT + MO1-lef1 Fig. 3 from Ishitani et al., 2005
pigmentation disrupted, abnormal WT + MO1-lef1 Fig. 1 from Ishitani et al., 2005
post-anal tail morphogenesis disrupted, abnormal WT + MO1-lef1 Fig. 1 from Ishitani et al., 2005
post-vent region decreased length, abnormal WT + MO1-lef1 Fig. 2 with image from Dorsky et al., 2002
post-vent region truncated, abnormal WT + MO1-lef1 Fig. 2 with image from Dorsky et al., 2002
somite decreased amount, abnormal WT + MO1-lef1 Fig. 7 with image from Tee et al., 2009
trunk neural crest cell decreased amount, abnormal w25Tg + MO1-lef1 Fig. 3 from Ishitani et al., 2005
trunk neural crest cell positional polarity, abnormal WT + MO1-lef1 Fig. 2 from Ishitani et al., 2005
whole organism decreased pigmentation, abnormal WT + MO1-lef1 Fig. 1 from Ishitani et al., 2005
whole organism decreased size, abnormal WT + MO1-lef1 Fig. 1 from Ishitani et al., 2005
Phenotype of all Fish created by or utilizing MO1-lef1
Phenotype Fish Conditions Figures
melanocyte decreased amount, abnormal WT + MO1-lef1 standard conditions Fig. 3 from Ishitani et al., 2005
caudal fin morphology, abnormal WT + MO1-lef1 standard conditions Fig. 1 from Ishitani et al., 2005
cartilage morphogenesis disrupted, abnormal WT + MO1-lef1 standard conditions Fig. 1 from Ishitani et al., 2005
neural crest cell development disrupted, abnormal WT + MO1-lef1 standard conditions Fig. 1 from Ishitani et al., 2005
post-vent region decreased length, abnormal WT + MO1-lef1 standard conditions Fig. 2 with image from Dorsky et al., 2002
post-vent region truncated, abnormal WT + MO1-lef1 standard conditions Fig. 2 with image from Dorsky et al., 2002
paraxial mesoderm decreased size, abnormal WT + MO1-lef1 standard conditions Fig. 2 with image from Dorsky et al., 2002
somite decreased amount, abnormal WT + MO1-lef1 standard conditions Fig. 7 with image from Tee et al., 2009
whole organism decreased pigmentation, abnormal WT + MO1-lef1 standard conditions Fig. 1 from Ishitani et al., 2005
cranial cartilage morphology, abnormal WT + MO1-lef1 standard conditions Fig. 1 from Ishitani et al., 2005
trunk neural crest cell positional polarity, abnormal WT + MO1-lef1 standard conditions Fig. 2 from Ishitani et al., 2005
whole organism decreased size, abnormal WT + MO1-lef1 standard conditions Fig. 1 from Ishitani et al., 2005
dorsal root ganglion mislocalised, abnormal WT + MO1-lef1 standard conditions Fig. 1 from Ishitani et al., 2005
pigmentation disrupted, abnormal WT + MO1-lef1 standard conditions Fig. 1 from Ishitani et al., 2005
post-anal tail morphogenesis disrupted, abnormal WT + MO1-lef1 standard conditions Fig. 1 from Ishitani et al., 2005
pigment cell differentiation disrupted, abnormal WT + MO1-lef1 standard conditions Fig. 3 from Ishitani et al., 2005
dorsal root ganglion decreased amount, abnormal WT + MO1-lef1 standard conditions Fig. 1 from Ishitani et al., 2005
neural crest cell migration disrupted, abnormal WT + MO1-lef1 standard conditions Fig. 2 from Ishitani et al., 2005
trunk neural crest cell decreased amount, abnormal w25Tg + MO1-lef1 standard conditions Fig. 3 from Ishitani et al., 2005
somite decreased amount, abnormal apczf134/zf134; axin1tm13/tm13 + MO1-lef1 standard conditions Fig. 7 with image from Tee et al., 2009
Citations