Morpholino
MO2-mkks
- ID
- ZDB-MRPHLNO-060209-5
- Name
- MO2-mkks
- Previous Names
-
- bbs6MetMO (1)
- Target
- Sequence
-
5' - TTCTTCTTACTAATGCGAGACATGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-mkks
No data available
Phenotype
Phenotype resulting from MO2-mkks
No data available
Phenotype of all Fish created by or utilizing MO2-mkks
1 - 5 of 9 Show all
Citations
- Rachel, R.A., May-Simera, H.L., Veleri, S., Gotoh, N., Choi, B.Y., Murga-Zamalloa, C., McIntyre, J.C., Marek, J., Lopez, I., Hackett, A.N., Brooks, M., den Hollander, A.I., Beales, P.L., Li, T., Jacobson, S.G., Sood, R., Martens, J.R., Liu, P., Friedman, T.B., Khanna, H., Koenekoop, R.K., Kelley, M.W., and Swaroop, A. (2012) Combining Cep290 and Mkks ciliopathy alleles in mice rescues sensory defects and restores ciliogenesis. J. Clin. Invest.. 122(4):1233-1245
- Tayeh, M.K., Yen, H.J., Beck, J.S., Searby, C.C., Westfall, T.A., Griesbach, H., Sheffield, V.C., and Slusarski, D.C. (2008) Genetic interaction between Bardet-Biedl syndrome genes and implications for limb patterning. Human molecular genetics. 17(13):1956-1967
- Yen, H.J., Tayeh, M.K., Mullins, R.F., Stone, E.M., Sheffield, V.C., and Slusarski, D.C. (2006) Bardet-Biedl syndrome genes are important in retrograde intracellular trafficking and Kupffer's vesicle cilia function. Human molecular genetics. 15(5):667-677
1 - 3 of 3
Show