Morpholino

MO5-wnt8a

ID
ZDB-MRPHLNO-060130-9
Name
MO5-wnt8a
Previous Names
  • orf2 E4i4 MO (1)
Target
Sequence
5' - AACTGTTCTTACCAAGTCTGCCGTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genome Build: GRCz11Chromosome: 14
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-wnt8a
No data available
Phenotype
Phenotype resulting from MO5-wnt8a
No data available
Phenotype of all Fish created by or utilizing MO5-wnt8a
Phenotype Fish Conditions Figures
axis decreased length, abnormal AB + MO3-wnt8a + MO4-wnt8a + MO5-wnt8a + MO6-wnt8a standard conditions Fig. 1 with image from Ramel et al., 2005
notochord development disrupted, abnormal AB + MO3-wnt8a + MO4-wnt8a + MO5-wnt8a + MO6-wnt8a standard conditions Fig. 1 with image from Ramel et al., 2005
notochord structure, abnormal AB + MO3-wnt8a + MO4-wnt8a + MO5-wnt8a + MO6-wnt8a standard conditions Fig. 1 with image from Ramel et al., 2005
post-vent region mesoderm decreased size, abnormal AB + MO3-wnt8a + MO4-wnt8a + MO5-wnt8a + MO6-wnt8a standard conditions Fig. 1 with image from Ramel et al., 2005
trunk mesoderm decreased size, abnormal AB + MO3-wnt8a + MO4-wnt8a + MO5-wnt8a + MO6-wnt8a standard conditions Fig. 1 with image from Ramel et al., 2005
notochord increased width, abnormal AB + MO3-wnt8a + MO4-wnt8a + MO5-wnt8a + MO6-wnt8a standard conditions Fig. 1 with image from Ramel et al., 2005
axis mislocalised posteriorly, abnormal AB + MO3-wnt8a + MO4-wnt8a + MO5-wnt8a + MO6-wnt8a standard conditions Fig. 1 with image from Ramel et al., 2005
mesoderm formation disrupted, abnormal AB + MO3-wnt8a + MO4-wnt8a + MO5-wnt8a + MO6-wnt8a standard conditions Fig. 1 with image from Ramel et al., 2005
whole organism wholly dorsalized, abnormal WT + MO3-wnt8a + MO5-wnt8a standard conditions Fig. 4 with image from Kapp et al., 2013
axis decreased length, abnormal bmp2btc300a/+ + MO3-wnt8a + MO4-wnt8a + MO5-wnt8a + MO6-wnt8a (TU) standard conditions Fig. 1 with image from Ramel et al., 2005
convergent extension involved in gastrulation disrupted, abnormal bmp2btc300a/+ + MO3-wnt8a + MO4-wnt8a + MO5-wnt8a + MO6-wnt8a (TU) standard conditions Fig. 1 with image from Ramel et al., 2005
axis mislocalised posteriorly, abnormal bmp2btc300a/+ + MO3-wnt8a + MO4-wnt8a + MO5-wnt8a + MO6-wnt8a (TU) standard conditions Fig. 1 with image from Ramel et al., 2005
notochord morphology, abnormal bmp2btc300a/+ + MO3-wnt8a + MO4-wnt8a + MO5-wnt8a + MO6-wnt8a (TU) standard conditions Fig. 1 with image from Ramel et al., 2005
mesoderm formation disrupted, abnormal bmp2btc300a/+ + MO3-wnt8a + MO4-wnt8a + MO5-wnt8a + MO6-wnt8a (TU) standard conditions Fig. 1 with image from Ramel et al., 2005
whole organism elongated, abnormal bmp2btc300a/tc300a + MO3-wnt8a + MO4-wnt8a + MO5-wnt8a + MO6-wnt8a (TU) standard conditions Fig. 1 with image from Ramel et al., 2005
whole organism morphology, abnormal bmp2btc300a/tc300a + MO3-wnt8a + MO4-wnt8a + MO5-wnt8a + MO6-wnt8a (TU) standard conditions Fig. 1 with image from Ramel et al., 2005
dorsal/ventral pattern formation disrupted, abnormal bmp2btc300a/tc300a + MO3-wnt8a + MO4-wnt8a + MO5-wnt8a + MO6-wnt8a (TU) standard conditions Fig. 1 with image from Ramel et al., 2005
polarity specification of dorsal/ventral axis disrupted, abnormal bmp2btc300a/tc300a + MO3-wnt8a + MO4-wnt8a + MO5-wnt8a + MO6-wnt8a (TU) standard conditions Fig. 1 with image from Ramel et al., 2005
whole organism wholly ventralized, abnormal WT + MO1-chrd + MO3-wnt8a + MO5-wnt8a standard conditions Fig. 4 with image from Kapp et al., 2013
whole organism wholly dorsalized, abnormal ints6p18ahub + MO3-wnt8a + MO5-wnt8a (AB/TU) standard conditions Fig. 4 with image from Kapp et al., 2013
whole organism wholly dorsalized, abnormal ints6p18ahub + MO1-chrd + MO3-wnt8a + MO5-wnt8a (AB/TU) standard conditions Fig. 4 with image from Kapp et al., 2013
Citations